Mutagenetix > Incidental Mutations

Incidental Mutation 'R3950:Ahnak2'

307890

Institutional Source

Beutler Lab

Gene Symbol

Ahnak2

Ensembl Gene

ENSMUSG00000072812

Gene Name

AHNAK nucleoprotein 2

Synonyms

LOC382643

MMRRC Submission

040930-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.067) question?

Stock #

R3950 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

112772194-112802657 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 112785789 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 186 (I186N)

Ref Sequence

ENSEMBL: ENSMUSP00000114522 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000124526]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000124526
AA Change: I186N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000114522
Gene: ENSMUSG00000072812
AA Change: I186N

Domain	Start	End	E-Value	Type
low complexity region	73	94	N/A	INTRINSIC
PDZ	118	190	6e-4	SMART
low complexity region	268	281	N/A	INTRINSIC
low complexity region	300	319	N/A	INTRINSIC
low complexity region	405	429	N/A	INTRINSIC
internal_repeat_1	465	898	2.74e-235	PROSPERO
low complexity region	905	923	N/A	INTRINSIC
low complexity region	990	1013	N/A	INTRINSIC
low complexity region	1076	1092	N/A	INTRINSIC
internal_repeat_1	1145	1588	2.74e-235	PROSPERO
low complexity region	1590	1632	N/A	INTRINSIC
low complexity region	1639	1700	N/A	INTRINSIC
low complexity region	1709	1736	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000137195

SMART Domains

Protein: ENSMUSP00000116582
Gene: ENSMUSG00000072812

Domain	Start	End	E-Value	Type
internal_repeat_1	2	521	3.81e-221	PROSPERO
low complexity region	557	569	N/A	INTRINSIC
internal_repeat_1	606	1126	3.81e-221	PROSPERO

Meta Mutation Damage Score

0.5685

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932414N04Rik	T	C	2: 68,664,403		probably null	Het
Appbp2	A	G	11: 85,194,706	I458T	probably damaging	Het
Arhgef25	T	C	10: 127,185,144	Y291C	probably damaging	Het
Ate1	T	C	7: 130,467,292	Y415C	probably damaging	Het
B4galt4	G	T	16: 38,768,022	A72S	probably benign	Het
C3	T	C	17: 57,225,286	R178G	probably benign	Het
Cdh23	T	C	10: 60,657,326	Y3C	probably benign	Het
Col11a1	T	C	3: 114,121,445		probably null	Het
Col22a1	A	G	15: 71,977,358	F294L	possibly damaging	Het
Dera	A	G	6: 137,837,120	Y100C	probably damaging	Het
Dync2h1	A	T	9: 7,112,061	Y276*	probably null	Het
Eea1	A	T	10: 96,042,134	N1389I	probably damaging	Het
Epha4	A	T	1: 77,399,716	Y509N	probably damaging	Het
Fat3	G	A	9: 15,998,271	S2145F	probably damaging	Het
Fezf1	T	A	6: 23,247,420	K219*	probably null	Het
Fsd1	G	A	17: 55,995,517		probably null	Het
Haspin	A	G	11: 73,136,395	Y623H	probably damaging	Het
Hsd3b1	C	T	3: 98,856,138	V56M	possibly damaging	Het
Hyou1	C	T	9: 44,385,227	T483I	probably damaging	Het
Kdm2a	A	G	19: 4,343,232	L365S	possibly damaging	Het
Kdm6b	G	T	11: 69,405,615	P609T	probably damaging	Het
Klhl18	T	A	9: 110,428,902	Y490F	probably damaging	Het
Ky	C	T	9: 102,542,428	Q545*	probably null	Het
L1td1	T	C	4: 98,737,353	L595P	probably benign	Het
Map3k20	T	G	2: 72,438,300	I550M	probably damaging	Het
Mug1	T	A	6: 121,878,530	V941E	probably damaging	Het
Ndst1	T	C	18: 60,697,139	N633S	probably benign	Het
Ninl	A	T	2: 150,952,488	I740K	possibly damaging	Het
Npepl1	A	G	2: 174,121,113	N431D	probably damaging	Het
Olfr1128	T	C	2: 87,545,065	T160A	probably damaging	Het
Pacs2	T	C	12: 113,061,113	S408P	probably damaging	Het
Pard6b	C	T	2: 168,099,194	T367I	probably damaging	Het
Pcdhga7	A	G	18: 37,716,515	E525G	probably damaging	Het
Pctp	A	G	11: 89,987,318	I130T	probably benign	Het
Pcx	C	T	19: 4,617,967	H506Y	probably benign	Het
Pdhx	A	G	2: 103,035,241	S199P	probably damaging	Het
Pdia2	C	A	17: 26,197,616		probably null	Het
Pif1	C	A	9: 65,591,834	N445K	probably damaging	Het
Prickle4	T	C	17: 47,688,582	K349E	probably benign	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Ptpdc1	A	T	13: 48,589,194	M173K	probably damaging	Het
Rb1	A	G	14: 73,262,662	L515P	probably damaging	Het
Rcvrn	A	G	11: 67,700,051	K154E	probably damaging	Het
Ros1	C	T	10: 52,066,388	V2059I	probably damaging	Het
Rtn4ip1	T	A	10: 43,909,897		probably null	Het
Sema5a	T	C	15: 32,689,338	Y1050H	probably damaging	Het
Slc25a28	C	T	19: 43,664,269	V318I	probably benign	Het
Srek1	G	A	13: 103,744,895	R408W	unknown	Het
Synrg	C	T	11: 83,989,815	T444I	probably damaging	Het
Ticrr	T	C	7: 79,682,069	L776S	probably damaging	Het
Tmem127	T	C	2: 127,248,657	L31P	probably damaging	Het
Tmprss15	T	A	16: 79,073,186	T190S	probably benign	Het
Trip10	T	A	17: 57,253,411		probably null	Het
Ttc6	A	G	12: 57,649,506	Y31C	probably damaging	Het
Unc80	A	T	1: 66,622,570	H1718L	possibly damaging	Het
Zbtb38	A	G	9: 96,687,546	F495S	probably damaging	Het
Zfp280d	G	T	9: 72,296,019	Q16H	possibly damaging	Het
Zfp521	A	G	18: 13,846,346	S337P	probably damaging	Het
Zswim9	T	A	7: 13,261,577	T218S	possibly damaging	Het

Other mutations in Ahnak2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02257:Ahnak2	APN	12	112785285	missense	possibly damaging	0.79
IGL02994:Ahnak2	APN	12	112786207	missense	probably damaging	0.99
PIT4480001:Ahnak2	UTSW	12	112773924	missense	possibly damaging	0.79
PIT4810001:Ahnak2	UTSW	12	112785594	missense
R0025:Ahnak2	UTSW	12	112785534	missense	probably damaging	0.99
R0025:Ahnak2	UTSW	12	112785534	missense	probably damaging	0.99
R0038:Ahnak2	UTSW	12	112774462	missense	probably benign	0.00
R0125:Ahnak2	UTSW	12	112785156	missense	probably benign	0.41
R1173:Ahnak2	UTSW	12	112785789	missense	probably damaging	1.00
R1494:Ahnak2	UTSW	12	112787950	missense	probably damaging	1.00
R1712:Ahnak2	UTSW	12	112785378	missense	probably benign	0.05
R1888:Ahnak2	UTSW	12	112773891	missense	possibly damaging	0.49
R1888:Ahnak2	UTSW	12	112773891	missense	possibly damaging	0.49
R2042:Ahnak2	UTSW	12	112785819	missense	probably damaging	0.98
R2056:Ahnak2	UTSW	12	112785006	missense	probably benign	0.00
R2417:Ahnak2	UTSW	12	112775371	missense	probably damaging	1.00
R2762:Ahnak2	UTSW	12	112785364	missense	probably damaging	0.96
R3618:Ahnak2	UTSW	12	112786222	missense	probably damaging	1.00
R3706:Ahnak2	UTSW	12	112773651	missense	possibly damaging	0.74
R3739:Ahnak2	UTSW	12	112774558	missense	probably benign	0.05
R4485:Ahnak2	UTSW	12	112779767	unclassified	probably benign
R4651:Ahnak2	UTSW	12	112774837	missense	possibly damaging	0.93
R4652:Ahnak2	UTSW	12	112774837	missense	possibly damaging	0.93
R4831:Ahnak2	UTSW	12	112775749	missense	probably damaging	0.99
R4836:Ahnak2	UTSW	12	112774116	missense	probably damaging	1.00
R4837:Ahnak2	UTSW	12	112785739	missense	probably benign	0.00
R4864:Ahnak2	UTSW	12	112773606	missense	probably damaging	0.98
R4908:Ahnak2	UTSW	12	112775272	missense	probably benign	0.00
R5067:Ahnak2	UTSW	12	112785316	missense	probably benign	0.01
R5146:Ahnak2	UTSW	12	112775726	missense	probably benign	0.00
R5228:Ahnak2	UTSW	12	112775386	missense	probably benign	0.03
R5255:Ahnak2	UTSW	12	112773378	missense	possibly damaging	0.92
R5323:Ahnak2	UTSW	12	112779812	unclassified	probably benign
R5523:Ahnak2	UTSW	12	112775208	missense	probably damaging	1.00
R5733:Ahnak2	UTSW	12	112775666	nonsense	probably null
R5799:Ahnak2	UTSW	12	112778930	unclassified	probably benign
R5817:Ahnak2	UTSW	12	112774003	missense	probably damaging	1.00
R5835:Ahnak2	UTSW	12	112775796	missense	possibly damaging	0.66
R6083:Ahnak2	UTSW	12	112782612	missense	probably benign	0.06
R6083:Ahnak2	UTSW	12	112782999	missense	probably benign	0.01
R6167:Ahnak2	UTSW	12	112783122	missense	probably benign	0.03
R6168:Ahnak2	UTSW	12	112783122	missense	probably benign	0.03
R6405:Ahnak2	UTSW	12	112773337	missense	probably damaging	1.00
R6460:Ahnak2	UTSW	12	112786990	missense	probably null	0.27
R6495:Ahnak2	UTSW	12	112773714	missense	probably damaging	1.00
R6544:Ahnak2	UTSW	12	112780652	unclassified	probably benign
R6656:Ahnak2	UTSW	12	112785371	missense	probably benign	0.02
R6679:Ahnak2	UTSW	12	112772976	missense	probably damaging	1.00
R6723:Ahnak2	UTSW	12	112778793	missense	probably damaging	1.00
R6774:Ahnak2	UTSW	12	112773738	missense	possibly damaging	0.87
R6884:Ahnak2	UTSW	12	112775429	missense	possibly damaging	0.81
R6906:Ahnak2	UTSW	12	112785313	missense	probably benign	0.00
R6919:Ahnak2	UTSW	12	112774684	missense	possibly damaging	0.55
R7036:Ahnak2	UTSW	12	112778781	unclassified	probably benign
R7037:Ahnak2	UTSW	12	112774278	missense	probably damaging	0.99
R7064:Ahnak2	UTSW	12	112780742	unclassified	probably benign
R7072:Ahnak2	UTSW	12	112788166	missense
R7112:Ahnak2	UTSW	12	112783119	missense
R7268:Ahnak2	UTSW	12	112780802	missense
R7269:Ahnak2	UTSW	12	112780802	missense
R7270:Ahnak2	UTSW	12	112780802	missense
R7271:Ahnak2	UTSW	12	112780802	missense
R7444:Ahnak2	UTSW	12	112781208	missense
R7448:Ahnak2	UTSW	12	112782502	missense
R7488:Ahnak2	UTSW	12	112785021	missense
R7508:Ahnak2	UTSW	12	112774405	missense	possibly damaging	0.46
R7560:Ahnak2	UTSW	12	112779674	missense
R7611:Ahnak2	UTSW	12	112788129	missense
R7743:Ahnak2	UTSW	12	112784763	missense	not run
R7762:Ahnak2	UTSW	12	112775680	missense	probably benign	0.27
R7780:Ahnak2	UTSW	12	112782613	missense
R7930:Ahnak2	UTSW	12	112779125	missense
R7985:Ahnak2	UTSW	12	112778963	missense
R8114:Ahnak2	UTSW	12	112774729	missense	probably benign	0.05
R8122:Ahnak2	UTSW	12	112776076	missense	possibly damaging	0.83
R8240:Ahnak2	UTSW	12	112774648	missense	probably benign	0.03
R8289:Ahnak2	UTSW	12	112775808	missense	possibly damaging	0.46
R8315:Ahnak2	UTSW	12	112781133	missense
R8430:Ahnak2	UTSW	12	112774687	missense	possibly damaging	0.86
R8476:Ahnak2	UTSW	12	112782991	unclassified	probably benign
R8712:Ahnak2	UTSW	12	112786252	missense
R8712:Ahnak2	UTSW	12	112787089	missense
R8778:Ahnak2	UTSW	12	112783158	missense
R8830:Ahnak2	UTSW	12	112787036	missense
R9014:Ahnak2	UTSW	12	112773736	missense	possibly damaging	0.95
R9055:Ahnak2	UTSW	12	112774585	missense	possibly damaging	0.90
R9327:Ahnak2	UTSW	12	112784826	missense
R9386:Ahnak2	UTSW	12	112778993	missense
Z1177:Ahnak2	UTSW	12	112781199	missense

Predicted Primers

PCR Primer
(F):5'- GCAATGTCCTTGTCCTGAAAC -3'
(R):5'- TTGGGGAGCTGGACAAATGC -3'

Sequencing Primer
(F):5'- TGTCCTTGTCCTGAAACAGAAGG -3'
(R):5'- GCTGGACAAATGCCAATATGC -3'

Posted On

2015-04-17