Incidental Mutation 'R3950:Srek1'
ID 307894
Institutional Source Beutler Lab
Gene Symbol Srek1
Ensembl Gene ENSMUSG00000032621
Gene Name splicing regulatory glutamine/lysine-rich protein 1
Synonyms SRrp508, Sfrs12, SRrp86
MMRRC Submission 040930-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock # R3950 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 103739348-103774608 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 103744895 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 408 (R408W)
Ref Sequence ENSEMBL: ENSMUSP00000147737 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074616] [ENSMUST00000210489]
AlphaFold Q8BZX4
Predicted Effect unknown
Transcript: ENSMUST00000074616
AA Change: R524W
SMART Domains Protein: ENSMUSP00000074196
Gene: ENSMUSG00000032621
AA Change: R524W

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
RRM 70 141 1.22e-18 SMART
coiled coil region 259 298 N/A INTRINSIC
low complexity region 356 395 N/A INTRINSIC
low complexity region 397 408 N/A INTRINSIC
low complexity region 414 427 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210269
Predicted Effect unknown
Transcript: ENSMUST00000210489
AA Change: R408W
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211491
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of serine/arginine-rich (SR) splicing proteins containing RNA recognition motif (RRM) domains. The encoded protein interacts with other SR proteins to modulate splice site selection. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,664,403 probably null Het
Ahnak2 A T 12: 112,785,789 I186N probably damaging Het
Appbp2 A G 11: 85,194,706 I458T probably damaging Het
Arhgef25 T C 10: 127,185,144 Y291C probably damaging Het
Ate1 T C 7: 130,467,292 Y415C probably damaging Het
B4galt4 G T 16: 38,768,022 A72S probably benign Het
C3 T C 17: 57,225,286 R178G probably benign Het
Cdh23 T C 10: 60,657,326 Y3C probably benign Het
Col11a1 T C 3: 114,121,445 probably null Het
Col22a1 A G 15: 71,977,358 F294L possibly damaging Het
Dera A G 6: 137,837,120 Y100C probably damaging Het
Dync2h1 A T 9: 7,112,061 Y276* probably null Het
Eea1 A T 10: 96,042,134 N1389I probably damaging Het
Epha4 A T 1: 77,399,716 Y509N probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fezf1 T A 6: 23,247,420 K219* probably null Het
Fsd1 G A 17: 55,995,517 probably null Het
Haspin A G 11: 73,136,395 Y623H probably damaging Het
Hsd3b1 C T 3: 98,856,138 V56M possibly damaging Het
Hyou1 C T 9: 44,385,227 T483I probably damaging Het
Kdm2a A G 19: 4,343,232 L365S possibly damaging Het
Kdm6b G T 11: 69,405,615 P609T probably damaging Het
Klhl18 T A 9: 110,428,902 Y490F probably damaging Het
Ky C T 9: 102,542,428 Q545* probably null Het
L1td1 T C 4: 98,737,353 L595P probably benign Het
Map3k20 T G 2: 72,438,300 I550M probably damaging Het
Mug1 T A 6: 121,878,530 V941E probably damaging Het
Ndst1 T C 18: 60,697,139 N633S probably benign Het
Ninl A T 2: 150,952,488 I740K possibly damaging Het
Npepl1 A G 2: 174,121,113 N431D probably damaging Het
Olfr1128 T C 2: 87,545,065 T160A probably damaging Het
Pacs2 T C 12: 113,061,113 S408P probably damaging Het
Pard6b C T 2: 168,099,194 T367I probably damaging Het
Pcdhga7 A G 18: 37,716,515 E525G probably damaging Het
Pctp A G 11: 89,987,318 I130T probably benign Het
Pcx C T 19: 4,617,967 H506Y probably benign Het
Pdhx A G 2: 103,035,241 S199P probably damaging Het
Pdia2 C A 17: 26,197,616 probably null Het
Pif1 C A 9: 65,591,834 N445K probably damaging Het
Prickle4 T C 17: 47,688,582 K349E probably benign Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptpdc1 A T 13: 48,589,194 M173K probably damaging Het
Rb1 A G 14: 73,262,662 L515P probably damaging Het
Rcvrn A G 11: 67,700,051 K154E probably damaging Het
Ros1 C T 10: 52,066,388 V2059I probably damaging Het
Rtn4ip1 T A 10: 43,909,897 probably null Het
Sema5a T C 15: 32,689,338 Y1050H probably damaging Het
Slc25a28 C T 19: 43,664,269 V318I probably benign Het
Synrg C T 11: 83,989,815 T444I probably damaging Het
Ticrr T C 7: 79,682,069 L776S probably damaging Het
Tmem127 T C 2: 127,248,657 L31P probably damaging Het
Tmprss15 T A 16: 79,073,186 T190S probably benign Het
Trip10 T A 17: 57,253,411 probably null Het
Ttc6 A G 12: 57,649,506 Y31C probably damaging Het
Unc80 A T 1: 66,622,570 H1718L possibly damaging Het
Zbtb38 A G 9: 96,687,546 F495S probably damaging Het
Zfp280d G T 9: 72,296,019 Q16H possibly damaging Het
Zfp521 A G 18: 13,846,346 S337P probably damaging Het
Zswim9 T A 7: 13,261,577 T218S possibly damaging Het
Other mutations in Srek1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01756:Srek1 APN 13 103760582 missense probably damaging 1.00
IGL01834:Srek1 APN 13 103748785 unclassified probably benign
IGL03029:Srek1 APN 13 103763960 utr 5 prime probably benign
IGL03198:Srek1 APN 13 103744935 splice site probably null
IGL03284:Srek1 APN 13 103760537 missense probably damaging 0.96
inscruitable UTSW 13 103774386 missense probably damaging 1.00
PIT4453001:Srek1 UTSW 13 103744783 critical splice donor site probably null
R0080:Srek1 UTSW 13 103743686 missense unknown
R0082:Srek1 UTSW 13 103743686 missense unknown
R0106:Srek1 UTSW 13 103743623 missense unknown
R0106:Srek1 UTSW 13 103743623 missense unknown
R0506:Srek1 UTSW 13 103760590 missense probably damaging 0.99
R0569:Srek1 UTSW 13 103748862 unclassified probably benign
R0969:Srek1 UTSW 13 103752503 unclassified probably benign
R1617:Srek1 UTSW 13 103743604 missense unknown
R2098:Srek1 UTSW 13 103744855 missense unknown
R2423:Srek1 UTSW 13 103753028 nonsense probably null
R4347:Srek1 UTSW 13 103748759 missense probably null
R4676:Srek1 UTSW 13 103758187 splice site probably benign
R4915:Srek1 UTSW 13 103752563 unclassified probably benign
R4915:Srek1 UTSW 13 103752686 utr 3 prime probably benign
R5119:Srek1 UTSW 13 103752556 unclassified probably benign
R5677:Srek1 UTSW 13 103759244 missense probably damaging 0.98
R6135:Srek1 UTSW 13 103774386 missense probably damaging 1.00
R6458:Srek1 UTSW 13 103743568 missense probably benign 0.01
R7406:Srek1 UTSW 13 103769382 missense probably damaging 1.00
R8537:Srek1 UTSW 13 103752449 unclassified probably benign
R9269:Srek1 UTSW 13 103753146 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TGGTTCTCATCTCTTCAAAGGC -3'
(R):5'- GGCTGGCTACTGCTGAAATC -3'

Sequencing Primer
(F):5'- CATCTCTTCAAAGGCAGTAAGAGTG -3'
(R):5'- TCACTTTAACCCTGAGTGAAGC -3'
Posted On 2015-04-17