Mutagenetix > Incidental Mutations

Incidental Mutation 'R3950:B4galt4'

307899

Institutional Source

Beutler Lab

Gene Symbol

B4galt4

Ensembl Gene

ENSMUSG00000022793

Gene Name

UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 4

Synonyms

MMRRC Submission

040930-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.218) question?

Stock #

R3950 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

38742264-38769049 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 38768022 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Serine at position 72 (A72S)

Ref Sequence

ENSEMBL: ENSMUSP00000155991 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023482] [ENSMUST00000114708] [ENSMUST00000114710] [ENSMUST00000114711] [ENSMUST00000114712] [ENSMUST00000154902] [ENSMUST00000232454]

AlphaFold

Q9JJ04

Predicted Effect

probably benign
Transcript: ENSMUST00000023482
AA Change: A343S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000023482
Gene: ENSMUSG00000022793
AA Change: A343S

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
Pfam:Glyco_transf_7N	77	209	8.4e-63	PFAM
Pfam:Glyco_transf_7C	213	290	1e-30	PFAM
Pfam:Glyco_tranf_2_2	224	289	2.8e-8	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000114708
AA Change: A72S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000110356
Gene: ENSMUSG00000022793
AA Change: A72S

Domain	Start	End	E-Value	Type
SCOP:d1j8wb_	1	71	2e-30	SMART
PDB:2FYD\|D	1	73	3e-12	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000114710
AA Change: A72S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000110358
Gene: ENSMUSG00000022793
AA Change: A72S

Domain	Start	End	E-Value	Type
SCOP:d1j8wb_	1	71	2e-30	SMART
PDB:2FYD\|D	1	73	3e-12	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000114711
AA Change: A72S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000110359
Gene: ENSMUSG00000022793
AA Change: A72S

Domain	Start	End	E-Value	Type
SCOP:d1j8wb_	1	71	2e-30	SMART
PDB:2FYD\|D	1	73	3e-12	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000114712
AA Change: A343S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000110360
Gene: ENSMUSG00000022793
AA Change: A343S

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
Pfam:Glyco_transf_7N	77	211	6.2e-58	PFAM
Pfam:Glyco_transf_7C	213	290	6.9e-31	PFAM
Pfam:Glyco_tranf_2_2	224	289	3.1e-8	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000154902

SMART Domains

Protein: ENSMUSP00000118593
Gene: ENSMUSG00000022793

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
Pfam:Glyco_transf_7N	77	211	5.9e-59	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161010

Predicted Effect

probably benign
Transcript: ENSMUST00000232454
AA Change: A72S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of seven beta-1,4-galactosyltransferase (beta4GalT) genes. They encode type II membrane-bound glycoproteins that appear to have exclusive specificity for the donor substrate UDP-galactose; all transfer galactose in a beta1,4 linkage to similar acceptor sugars: GlcNAc, Glc, and Xyl. Each beta4GalT has a distinct function in the biosynthesis of different glycoconjugates and saccharide structures. As type II membrane proteins, they have an N-terminal hydrophobic signal sequence that directs the protein to the Golgi apparatus and which then remains uncleaved to function as a transmembrane anchor. By sequence similarity, the beta4GalTs form four groups: beta4GalT1 and beta4GalT2, beta4GalT3 and beta4GalT4, beta4GalT5 and beta4GalT6, and beta4GalT7. The enzyme encoded by this gene appears to mainly play a role in glycolipid biosynthesis. Two alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932414N04Rik	T	C	2: 68,664,403		probably null	Het
Ahnak2	A	T	12: 112,785,789	I186N	probably damaging	Het
Appbp2	A	G	11: 85,194,706	I458T	probably damaging	Het
Arhgef25	T	C	10: 127,185,144	Y291C	probably damaging	Het
Ate1	T	C	7: 130,467,292	Y415C	probably damaging	Het
C3	T	C	17: 57,225,286	R178G	probably benign	Het
Cdh23	T	C	10: 60,657,326	Y3C	probably benign	Het
Col11a1	T	C	3: 114,121,445		probably null	Het
Col22a1	A	G	15: 71,977,358	F294L	possibly damaging	Het
Dera	A	G	6: 137,837,120	Y100C	probably damaging	Het
Dync2h1	A	T	9: 7,112,061	Y276*	probably null	Het
Eea1	A	T	10: 96,042,134	N1389I	probably damaging	Het
Epha4	A	T	1: 77,399,716	Y509N	probably damaging	Het
Fat3	G	A	9: 15,998,271	S2145F	probably damaging	Het
Fezf1	T	A	6: 23,247,420	K219*	probably null	Het
Fsd1	G	A	17: 55,995,517		probably null	Het
Haspin	A	G	11: 73,136,395	Y623H	probably damaging	Het
Hsd3b1	C	T	3: 98,856,138	V56M	possibly damaging	Het
Hyou1	C	T	9: 44,385,227	T483I	probably damaging	Het
Kdm2a	A	G	19: 4,343,232	L365S	possibly damaging	Het
Kdm6b	G	T	11: 69,405,615	P609T	probably damaging	Het
Klhl18	T	A	9: 110,428,902	Y490F	probably damaging	Het
Ky	C	T	9: 102,542,428	Q545*	probably null	Het
L1td1	T	C	4: 98,737,353	L595P	probably benign	Het
Map3k20	T	G	2: 72,438,300	I550M	probably damaging	Het
Mug1	T	A	6: 121,878,530	V941E	probably damaging	Het
Ndst1	T	C	18: 60,697,139	N633S	probably benign	Het
Ninl	A	T	2: 150,952,488	I740K	possibly damaging	Het
Npepl1	A	G	2: 174,121,113	N431D	probably damaging	Het
Olfr1128	T	C	2: 87,545,065	T160A	probably damaging	Het
Pacs2	T	C	12: 113,061,113	S408P	probably damaging	Het
Pard6b	C	T	2: 168,099,194	T367I	probably damaging	Het
Pcdhga7	A	G	18: 37,716,515	E525G	probably damaging	Het
Pctp	A	G	11: 89,987,318	I130T	probably benign	Het
Pcx	C	T	19: 4,617,967	H506Y	probably benign	Het
Pdhx	A	G	2: 103,035,241	S199P	probably damaging	Het
Pdia2	C	A	17: 26,197,616		probably null	Het
Pif1	C	A	9: 65,591,834	N445K	probably damaging	Het
Prickle4	T	C	17: 47,688,582	K349E	probably benign	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Ptpdc1	A	T	13: 48,589,194	M173K	probably damaging	Het
Rb1	A	G	14: 73,262,662	L515P	probably damaging	Het
Rcvrn	A	G	11: 67,700,051	K154E	probably damaging	Het
Ros1	C	T	10: 52,066,388	V2059I	probably damaging	Het
Rtn4ip1	T	A	10: 43,909,897		probably null	Het
Sema5a	T	C	15: 32,689,338	Y1050H	probably damaging	Het
Slc25a28	C	T	19: 43,664,269	V318I	probably benign	Het
Srek1	G	A	13: 103,744,895	R408W	unknown	Het
Synrg	C	T	11: 83,989,815	T444I	probably damaging	Het
Ticrr	T	C	7: 79,682,069	L776S	probably damaging	Het
Tmem127	T	C	2: 127,248,657	L31P	probably damaging	Het
Tmprss15	T	A	16: 79,073,186	T190S	probably benign	Het
Trip10	T	A	17: 57,253,411		probably null	Het
Ttc6	A	G	12: 57,649,506	Y31C	probably damaging	Het
Unc80	A	T	1: 66,622,570	H1718L	possibly damaging	Het
Zbtb38	A	G	9: 96,687,546	F495S	probably damaging	Het
Zfp280d	G	T	9: 72,296,019	Q16H	possibly damaging	Het
Zfp521	A	G	18: 13,846,346	S337P	probably damaging	Het
Zswim9	T	A	7: 13,261,577	T218S	possibly damaging	Het

Other mutations in B4galt4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01356:B4galt4	APN	16	38754144	missense	probably damaging	1.00
IGL01414:B4galt4	APN	16	38757791	missense	probably damaging	1.00
R0831:B4galt4	UTSW	16	38767979	missense	probably benign	0.01
R2125:B4galt4	UTSW	16	38765938	missense	probably damaging	0.99
R4334:B4galt4	UTSW	16	38752259	missense	probably damaging	0.99
R4773:B4galt4	UTSW	16	38752296	missense	probably benign	0.37
R6499:B4galt4	UTSW	16	38757822	missense	probably benign	0.00
R6706:B4galt4	UTSW	16	38757811	missense	probably benign	0.06
R7208:B4galt4	UTSW	16	38753940	missense	probably damaging	1.00
R7500:B4galt4	UTSW	16	38768014	missense	probably damaging	1.00
R7548:B4galt4	UTSW	16	38754066	missense	probably damaging	1.00
R7792:B4galt4	UTSW	16	38757810	nonsense	probably null
R8058:B4galt4	UTSW	16	38766021	critical splice donor site	probably null
R8202:B4galt4	UTSW	16	38767912	missense	probably benign
R8900:B4galt4	UTSW	16	38752042	utr 5 prime	probably benign

Predicted Primers

PCR Primer
(F):5'- GTATGAGAACACTTTGGGGCAG -3'
(R):5'- CAACCAAGAAAAGCTGTCTTGTTAC -3'

Sequencing Primer
(F):5'- CACTTTGGGGCAGGACAG -3'
(R):5'- AAGCTGTCTTGTTACTATGGTTCTAC -3'

Posted On

2015-04-17