Incidental Mutation 'R3950:B4galt4'
ID 307899
Institutional Source Beutler Lab
Gene Symbol B4galt4
Ensembl Gene ENSMUSG00000022793
Gene Name UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 4
Synonyms
MMRRC Submission 040930-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.218) question?
Stock # R3950 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 38742264-38769049 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 38768022 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Serine at position 72 (A72S)
Ref Sequence ENSEMBL: ENSMUSP00000155991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023482] [ENSMUST00000114708] [ENSMUST00000114710] [ENSMUST00000114711] [ENSMUST00000114712] [ENSMUST00000154902] [ENSMUST00000232454]
AlphaFold Q9JJ04
Predicted Effect probably benign
Transcript: ENSMUST00000023482
AA Change: A343S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000023482
Gene: ENSMUSG00000022793
AA Change: A343S

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:Glyco_transf_7N 77 209 8.4e-63 PFAM
Pfam:Glyco_transf_7C 213 290 1e-30 PFAM
Pfam:Glyco_tranf_2_2 224 289 2.8e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114708
AA Change: A72S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110356
Gene: ENSMUSG00000022793
AA Change: A72S

DomainStartEndE-ValueType
SCOP:d1j8wb_ 1 71 2e-30 SMART
PDB:2FYD|D 1 73 3e-12 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000114710
AA Change: A72S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110358
Gene: ENSMUSG00000022793
AA Change: A72S

DomainStartEndE-ValueType
SCOP:d1j8wb_ 1 71 2e-30 SMART
PDB:2FYD|D 1 73 3e-12 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000114711
AA Change: A72S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110359
Gene: ENSMUSG00000022793
AA Change: A72S

DomainStartEndE-ValueType
SCOP:d1j8wb_ 1 71 2e-30 SMART
PDB:2FYD|D 1 73 3e-12 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000114712
AA Change: A343S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110360
Gene: ENSMUSG00000022793
AA Change: A343S

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:Glyco_transf_7N 77 211 6.2e-58 PFAM
Pfam:Glyco_transf_7C 213 290 6.9e-31 PFAM
Pfam:Glyco_tranf_2_2 224 289 3.1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154902
SMART Domains Protein: ENSMUSP00000118593
Gene: ENSMUSG00000022793

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:Glyco_transf_7N 77 211 5.9e-59 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161010
Predicted Effect probably benign
Transcript: ENSMUST00000232454
AA Change: A72S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of seven beta-1,4-galactosyltransferase (beta4GalT) genes. They encode type II membrane-bound glycoproteins that appear to have exclusive specificity for the donor substrate UDP-galactose; all transfer galactose in a beta1,4 linkage to similar acceptor sugars: GlcNAc, Glc, and Xyl. Each beta4GalT has a distinct function in the biosynthesis of different glycoconjugates and saccharide structures. As type II membrane proteins, they have an N-terminal hydrophobic signal sequence that directs the protein to the Golgi apparatus and which then remains uncleaved to function as a transmembrane anchor. By sequence similarity, the beta4GalTs form four groups: beta4GalT1 and beta4GalT2, beta4GalT3 and beta4GalT4, beta4GalT5 and beta4GalT6, and beta4GalT7. The enzyme encoded by this gene appears to mainly play a role in glycolipid biosynthesis. Two alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,664,403 probably null Het
Ahnak2 A T 12: 112,785,789 I186N probably damaging Het
Appbp2 A G 11: 85,194,706 I458T probably damaging Het
Arhgef25 T C 10: 127,185,144 Y291C probably damaging Het
Ate1 T C 7: 130,467,292 Y415C probably damaging Het
C3 T C 17: 57,225,286 R178G probably benign Het
Cdh23 T C 10: 60,657,326 Y3C probably benign Het
Col11a1 T C 3: 114,121,445 probably null Het
Col22a1 A G 15: 71,977,358 F294L possibly damaging Het
Dera A G 6: 137,837,120 Y100C probably damaging Het
Dync2h1 A T 9: 7,112,061 Y276* probably null Het
Eea1 A T 10: 96,042,134 N1389I probably damaging Het
Epha4 A T 1: 77,399,716 Y509N probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fezf1 T A 6: 23,247,420 K219* probably null Het
Fsd1 G A 17: 55,995,517 probably null Het
Haspin A G 11: 73,136,395 Y623H probably damaging Het
Hsd3b1 C T 3: 98,856,138 V56M possibly damaging Het
Hyou1 C T 9: 44,385,227 T483I probably damaging Het
Kdm2a A G 19: 4,343,232 L365S possibly damaging Het
Kdm6b G T 11: 69,405,615 P609T probably damaging Het
Klhl18 T A 9: 110,428,902 Y490F probably damaging Het
Ky C T 9: 102,542,428 Q545* probably null Het
L1td1 T C 4: 98,737,353 L595P probably benign Het
Map3k20 T G 2: 72,438,300 I550M probably damaging Het
Mug1 T A 6: 121,878,530 V941E probably damaging Het
Ndst1 T C 18: 60,697,139 N633S probably benign Het
Ninl A T 2: 150,952,488 I740K possibly damaging Het
Npepl1 A G 2: 174,121,113 N431D probably damaging Het
Olfr1128 T C 2: 87,545,065 T160A probably damaging Het
Pacs2 T C 12: 113,061,113 S408P probably damaging Het
Pard6b C T 2: 168,099,194 T367I probably damaging Het
Pcdhga7 A G 18: 37,716,515 E525G probably damaging Het
Pctp A G 11: 89,987,318 I130T probably benign Het
Pcx C T 19: 4,617,967 H506Y probably benign Het
Pdhx A G 2: 103,035,241 S199P probably damaging Het
Pdia2 C A 17: 26,197,616 probably null Het
Pif1 C A 9: 65,591,834 N445K probably damaging Het
Prickle4 T C 17: 47,688,582 K349E probably benign Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptpdc1 A T 13: 48,589,194 M173K probably damaging Het
Rb1 A G 14: 73,262,662 L515P probably damaging Het
Rcvrn A G 11: 67,700,051 K154E probably damaging Het
Ros1 C T 10: 52,066,388 V2059I probably damaging Het
Rtn4ip1 T A 10: 43,909,897 probably null Het
Sema5a T C 15: 32,689,338 Y1050H probably damaging Het
Slc25a28 C T 19: 43,664,269 V318I probably benign Het
Srek1 G A 13: 103,744,895 R408W unknown Het
Synrg C T 11: 83,989,815 T444I probably damaging Het
Ticrr T C 7: 79,682,069 L776S probably damaging Het
Tmem127 T C 2: 127,248,657 L31P probably damaging Het
Tmprss15 T A 16: 79,073,186 T190S probably benign Het
Trip10 T A 17: 57,253,411 probably null Het
Ttc6 A G 12: 57,649,506 Y31C probably damaging Het
Unc80 A T 1: 66,622,570 H1718L possibly damaging Het
Zbtb38 A G 9: 96,687,546 F495S probably damaging Het
Zfp280d G T 9: 72,296,019 Q16H possibly damaging Het
Zfp521 A G 18: 13,846,346 S337P probably damaging Het
Zswim9 T A 7: 13,261,577 T218S possibly damaging Het
Other mutations in B4galt4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01356:B4galt4 APN 16 38754144 missense probably damaging 1.00
IGL01414:B4galt4 APN 16 38757791 missense probably damaging 1.00
R0831:B4galt4 UTSW 16 38767979 missense probably benign 0.01
R2125:B4galt4 UTSW 16 38765938 missense probably damaging 0.99
R4334:B4galt4 UTSW 16 38752259 missense probably damaging 0.99
R4773:B4galt4 UTSW 16 38752296 missense probably benign 0.37
R6499:B4galt4 UTSW 16 38757822 missense probably benign 0.00
R6706:B4galt4 UTSW 16 38757811 missense probably benign 0.06
R7208:B4galt4 UTSW 16 38753940 missense probably damaging 1.00
R7500:B4galt4 UTSW 16 38768014 missense probably damaging 1.00
R7548:B4galt4 UTSW 16 38754066 missense probably damaging 1.00
R7792:B4galt4 UTSW 16 38757810 nonsense probably null
R8058:B4galt4 UTSW 16 38766021 critical splice donor site probably null
R8202:B4galt4 UTSW 16 38767912 missense probably benign
R8900:B4galt4 UTSW 16 38752042 utr 5 prime probably benign
Predicted Primers PCR Primer
(F):5'- GTATGAGAACACTTTGGGGCAG -3'
(R):5'- CAACCAAGAAAAGCTGTCTTGTTAC -3'

Sequencing Primer
(F):5'- CACTTTGGGGCAGGACAG -3'
(R):5'- AAGCTGTCTTGTTACTATGGTTCTAC -3'
Posted On 2015-04-17