Incidental Mutation 'R0377:Map3k7'
ID30790
Institutional Source Beutler Lab
Gene Symbol Map3k7
Ensembl Gene ENSMUSG00000028284
Gene Namemitogen-activated protein kinase kinase kinase 7
SynonymsTGF-beta activated kinase 1, Tak1, transforming growth factor beta-activated kinase 1, transforming growth factor-beta-activated kinase 1, TAK1
MMRRC Submission 038583-MU
Accession Numbers

Ncbi RefSeq: NM_009316.1, NM_172688.3; MGI:1346877

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0377 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location31964097-32023467 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 31985731 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 218 (I218N)
Ref Sequence ENSEMBL: ENSMUSP00000103819 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037607] [ENSMUST00000080933] [ENSMUST00000108183] [ENSMUST00000108184]
Predicted Effect probably damaging
Transcript: ENSMUST00000037607
AA Change: I218N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000040307
Gene: ENSMUSG00000028284
AA Change: I218N

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:Pkinase_Tyr 36 284 1.2e-61 PFAM
Pfam:Pkinase 36 285 2.8e-56 PFAM
low complexity region 361 375 N/A INTRINSIC
low complexity region 453 463 N/A INTRINSIC
low complexity region 484 495 N/A INTRINSIC
coiled coil region 528 593 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000080933
AA Change: I218N

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000079734
Gene: ENSMUSG00000028284
AA Change: I218N

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:Pkinase_Tyr 36 284 1.7e-61 PFAM
Pfam:Pkinase 36 285 8.4e-58 PFAM
low complexity region 361 375 N/A INTRINSIC
low complexity region 426 436 N/A INTRINSIC
low complexity region 457 468 N/A INTRINSIC
coiled coil region 501 566 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108183
AA Change: I218N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000103818
Gene: ENSMUSG00000028284
AA Change: I218N

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
S_TKc 36 284 1.6e-63 SMART
low complexity region 361 375 N/A INTRINSIC
low complexity region 426 436 N/A INTRINSIC
low complexity region 457 468 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108184
AA Change: I218N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103819
Gene: ENSMUSG00000028284
AA Change: I218N

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:Pkinase_Tyr 36 284 5.6e-62 PFAM
Pfam:Pkinase 36 285 2.8e-58 PFAM
low complexity region 361 375 N/A INTRINSIC
low complexity region 453 463 N/A INTRINSIC
low complexity region 484 495 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126632
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131114
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143138
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147462
Meta Mutation Damage Score 0.9619 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.8%
Validation Efficiency 97% (67/69)
MGI Phenotype Strain: 3664194; 3608889; 3696053
Lethality: E9-E11
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis and may have impaired vascular remodeling, edema, or an open, wavy neural tube. Mice with conditional deletion in immune cells show impaired cell development and activation. [provided by MGI curators]
Allele List at MGI

All alleles(62) : Targeted(7) Gene trapped(55)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 C A 11: 94,375,096 V107F possibly damaging Het
Acad11 T A 9: 104,081,692 probably benign Het
Ache G A 5: 137,290,928 E299K possibly damaging Het
Adam5 T C 8: 24,747,541 T618A probably benign Het
Amigo2 T A 15: 97,246,380 T54S possibly damaging Het
Anapc1 A G 2: 128,641,340 probably null Het
Armc4 G A 18: 7,127,415 R933C probably benign Het
Btaf1 A G 19: 36,989,002 K1057E probably benign Het
Cep55 T A 19: 38,071,889 L396* probably null Het
Cic C A 7: 25,285,799 H1157N probably damaging Het
Cntnap5a A T 1: 116,292,529 T690S probably benign Het
D5Ertd579e A T 5: 36,604,567 C1319S probably benign Het
Dnah6 A G 6: 73,121,992 S2027P possibly damaging Het
Dntt G A 19: 41,047,627 W369* probably null Het
Esp18 T A 17: 39,409,944 W27R probably benign Het
Fam227b A T 2: 126,125,000 probably benign Het
Fbxo31 G A 8: 121,559,102 probably benign Het
Gm13547 G A 2: 29,761,791 probably null Het
Gnl2 T A 4: 125,046,382 probably benign Het
Gpx2 G A 12: 76,795,156 Q74* probably null Het
Gucy2c A G 6: 136,750,917 probably null Het
Hoxa5 A T 6: 52,202,646 W250R probably damaging Het
Izumo4 G A 10: 80,702,840 R42H probably damaging Het
Kcnj12 G A 11: 61,069,396 M71I probably benign Het
Kmt2b A T 7: 30,574,193 L2333Q probably damaging Het
Mak T C 13: 41,049,348 E177G probably damaging Het
Mark3 T C 12: 111,629,029 L393P probably damaging Het
Msh4 A G 3: 153,896,890 S234P probably benign Het
Mug1 A G 6: 121,857,361 D367G probably benign Het
Mypn A G 10: 63,127,622 probably benign Het
Ncapg T C 5: 45,693,817 V784A probably benign Het
Nutf2 T A 8: 105,878,872 V113D probably damaging Het
Olfr1080 A T 2: 86,553,583 D180E probably damaging Het
Opn3 T C 1: 175,663,694 M258V probably damaging Het
Osbpl7 A G 11: 97,055,934 D211G probably damaging Het
Pcnx C T 12: 81,974,579 probably benign Het
Plekhd1 G A 12: 80,706,436 probably benign Het
Pnpla6 A G 8: 3,541,501 E1165G probably damaging Het
Prkab2 T A 3: 97,662,317 D66E probably benign Het
Prpsap2 A G 11: 61,741,000 I177T possibly damaging Het
Ptpn23 A T 9: 110,388,132 S885R possibly damaging Het
Rab26 A T 17: 24,530,045 probably benign Het
Rab5a G A 17: 53,500,462 M175I probably benign Het
Rassf9 T A 10: 102,545,649 D297E probably benign Het
Rimbp2 C T 5: 128,803,861 R161Q probably damaging Het
Rtp1 A G 16: 23,431,284 Y133C probably damaging Het
Sdr16c5 G A 4: 4,005,546 L263F probably benign Het
Sec14l1 T G 11: 117,149,140 probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spaca1 T C 4: 34,044,267 probably null Het
Stk36 C T 1: 74,612,730 P394L probably benign Het
Stk4 T C 2: 164,096,800 I196T probably damaging Het
Sult1b1 A T 5: 87,517,376 M233K probably damaging Het
Tmem8b C T 4: 43,674,005 T212M probably damaging Het
Tmprss11g A T 5: 86,490,751 F293I probably damaging Het
Tnfsf11 T G 14: 78,299,912 T104P probably benign Het
Trmt2a G A 16: 18,249,703 R80Q possibly damaging Het
Trps1 C A 15: 50,831,778 E324* probably null Het
U2surp C T 9: 95,484,443 V470I probably benign Het
Wdr18 G A 10: 79,967,502 R400H probably benign Het
Wdr78 A G 4: 103,048,259 V775A probably damaging Het
Zfp119b T A 17: 55,938,671 H505L probably damaging Het
Zfp619 T A 7: 39,536,797 C750* probably null Het
Zfr T C 15: 12,160,591 I750T probably benign Het
Other mutations in Map3k7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Map3k7 APN 4 32019539 missense probably damaging 1.00
IGL01677:Map3k7 APN 4 32017158 intron probably benign
IGL02608:Map3k7 APN 4 31981452 splice site probably benign
IGL02796:Map3k7 UTSW 4 31979692 intron probably benign
R0498:Map3k7 UTSW 4 31974814 splice site probably benign
R1547:Map3k7 UTSW 4 31991796 missense probably benign 0.31
R2360:Map3k7 UTSW 4 31964302 missense unknown
R4709:Map3k7 UTSW 4 31985700 nonsense probably null
R4815:Map3k7 UTSW 4 31988592 missense probably damaging 0.98
R5497:Map3k7 UTSW 4 31991719 missense possibly damaging 0.56
R5813:Map3k7 UTSW 4 31964318 missense probably damaging 1.00
R6349:Map3k7 UTSW 4 31988661 missense possibly damaging 0.87
R7314:Map3k7 UTSW 4 31985769 nonsense probably null
X0066:Map3k7 UTSW 4 31974848 missense probably damaging 1.00
Z1176:Map3k7 UTSW 4 32015963 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGGAAGACCAGTGCATCTTGTTG -3'
(R):5'- AGTCTAAGTTCTCCCCACAGGACC -3'

Sequencing Primer
(F):5'- GACCAGTGCATCTTGTTGAAAAAG -3'
(R):5'- CTTCAGTATCAGATACACATGGTCTC -3'
Posted On2013-04-24