Mutagenetix > Incidental Mutations

Incidental Mutation 'R3950:Ndst1'

307908

Institutional Source

Beutler Lab

Gene Symbol

Ndst1

Ensembl Gene

ENSMUSG00000054008

Gene Name

N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1

Synonyms

glucosaminyl N-deacetylase/N-sulfotransferase 1, b2b2230Clo, Hsst, Ndst-1, 1200015G06Rik

MMRRC Submission

040930-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R3950 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

60685978-60713389 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 60697139 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 633 (N633S)

Ref Sequence

ENSEMBL: ENSMUSP00000126623 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000169273]

AlphaFold

Q3UHN9

Predicted Effect

probably benign
Transcript: ENSMUST00000169273
AA Change: N633S

PolyPhen 2 Score 0.118 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000126623
Gene: ENSMUSG00000054008
AA Change: N633S

Domain	Start	End	E-Value	Type
low complexity region	3	12	N/A	INTRINSIC
Pfam:HSNSD	25	515	5.1e-254	PFAM
Pfam:Sulfotransfer_1	604	869	2.2e-48	PFAM

Meta Mutation Damage Score

0.1548

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the heparan sulfate/heparin GlcNAc N-deacetylase/ N-sulfotransferase family. The encoded enzyme is a type II transmembrane protein that resides in the Golgi apparatus. The encoded protein catalyzes the transfer of sulfate from 3'-phosphoadenosine 5'-phosphosulfate to nitrogen of glucosamine in heparan sulfate. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene die late in gestation or neonatally. Lungs fail to inflate and mice born alive experience respiratory distress and failure. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932414N04Rik	T	C	2: 68,664,403		probably null	Het
Ahnak2	A	T	12: 112,785,789	I186N	probably damaging	Het
Appbp2	A	G	11: 85,194,706	I458T	probably damaging	Het
Arhgef25	T	C	10: 127,185,144	Y291C	probably damaging	Het
Ate1	T	C	7: 130,467,292	Y415C	probably damaging	Het
B4galt4	G	T	16: 38,768,022	A72S	probably benign	Het
C3	T	C	17: 57,225,286	R178G	probably benign	Het
Cdh23	T	C	10: 60,657,326	Y3C	probably benign	Het
Col11a1	T	C	3: 114,121,445		probably null	Het
Col22a1	A	G	15: 71,977,358	F294L	possibly damaging	Het
Dera	A	G	6: 137,837,120	Y100C	probably damaging	Het
Dync2h1	A	T	9: 7,112,061	Y276*	probably null	Het
Eea1	A	T	10: 96,042,134	N1389I	probably damaging	Het
Epha4	A	T	1: 77,399,716	Y509N	probably damaging	Het
Fat3	G	A	9: 15,998,271	S2145F	probably damaging	Het
Fezf1	T	A	6: 23,247,420	K219*	probably null	Het
Fsd1	G	A	17: 55,995,517		probably null	Het
Haspin	A	G	11: 73,136,395	Y623H	probably damaging	Het
Hsd3b1	C	T	3: 98,856,138	V56M	possibly damaging	Het
Hyou1	C	T	9: 44,385,227	T483I	probably damaging	Het
Kdm2a	A	G	19: 4,343,232	L365S	possibly damaging	Het
Kdm6b	G	T	11: 69,405,615	P609T	probably damaging	Het
Klhl18	T	A	9: 110,428,902	Y490F	probably damaging	Het
Ky	C	T	9: 102,542,428	Q545*	probably null	Het
L1td1	T	C	4: 98,737,353	L595P	probably benign	Het
Map3k20	T	G	2: 72,438,300	I550M	probably damaging	Het
Mug1	T	A	6: 121,878,530	V941E	probably damaging	Het
Ninl	A	T	2: 150,952,488	I740K	possibly damaging	Het
Npepl1	A	G	2: 174,121,113	N431D	probably damaging	Het
Olfr1128	T	C	2: 87,545,065	T160A	probably damaging	Het
Pacs2	T	C	12: 113,061,113	S408P	probably damaging	Het
Pard6b	C	T	2: 168,099,194	T367I	probably damaging	Het
Pcdhga7	A	G	18: 37,716,515	E525G	probably damaging	Het
Pctp	A	G	11: 89,987,318	I130T	probably benign	Het
Pcx	C	T	19: 4,617,967	H506Y	probably benign	Het
Pdhx	A	G	2: 103,035,241	S199P	probably damaging	Het
Pdia2	C	A	17: 26,197,616		probably null	Het
Pif1	C	A	9: 65,591,834	N445K	probably damaging	Het
Prickle4	T	C	17: 47,688,582	K349E	probably benign	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Ptpdc1	A	T	13: 48,589,194	M173K	probably damaging	Het
Rb1	A	G	14: 73,262,662	L515P	probably damaging	Het
Rcvrn	A	G	11: 67,700,051	K154E	probably damaging	Het
Ros1	C	T	10: 52,066,388	V2059I	probably damaging	Het
Rtn4ip1	T	A	10: 43,909,897		probably null	Het
Sema5a	T	C	15: 32,689,338	Y1050H	probably damaging	Het
Slc25a28	C	T	19: 43,664,269	V318I	probably benign	Het
Srek1	G	A	13: 103,744,895	R408W	unknown	Het
Synrg	C	T	11: 83,989,815	T444I	probably damaging	Het
Ticrr	T	C	7: 79,682,069	L776S	probably damaging	Het
Tmem127	T	C	2: 127,248,657	L31P	probably damaging	Het
Tmprss15	T	A	16: 79,073,186	T190S	probably benign	Het
Trip10	T	A	17: 57,253,411		probably null	Het
Ttc6	A	G	12: 57,649,506	Y31C	probably damaging	Het
Unc80	A	T	1: 66,622,570	H1718L	possibly damaging	Het
Zbtb38	A	G	9: 96,687,546	F495S	probably damaging	Het
Zfp280d	G	T	9: 72,296,019	Q16H	possibly damaging	Het
Zfp521	A	G	18: 13,846,346	S337P	probably damaging	Het
Zswim9	T	A	7: 13,261,577	T218S	possibly damaging	Het

Other mutations in Ndst1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Ndst1	APN	18	60707956	missense	probably damaging	1.00
IGL01410:Ndst1	APN	18	60700445	missense	probably damaging	1.00
IGL01578:Ndst1	APN	18	60713126	missense	probably damaging	1.00
IGL02133:Ndst1	APN	18	60699546	missense	probably benign	0.05
IGL03200:Ndst1	APN	18	60699539	missense	possibly damaging	0.86
R0631:Ndst1	UTSW	18	60700359	splice site	probably benign
R0899:Ndst1	UTSW	18	60707882	missense	probably benign	0.00
R1104:Ndst1	UTSW	18	60697146	missense	probably damaging	0.98
R1371:Ndst1	UTSW	18	60707647	missense	possibly damaging	0.90
R1456:Ndst1	UTSW	18	60713205	missense	possibly damaging	0.73
R1511:Ndst1	UTSW	18	60697170	missense	possibly damaging	0.61
R1524:Ndst1	UTSW	18	60698504	missense	probably damaging	0.99
R1699:Ndst1	UTSW	18	60695508	missense	probably damaging	1.00
R1718:Ndst1	UTSW	18	60707803	missense	probably damaging	0.99
R1772:Ndst1	UTSW	18	60702837	missense	probably damaging	0.99
R1900:Ndst1	UTSW	18	60712721	critical splice donor site	probably null
R2079:Ndst1	UTSW	18	60695509	missense	probably damaging	1.00
R2105:Ndst1	UTSW	18	60691253	missense	probably benign	0.01
R2127:Ndst1	UTSW	18	60691208	missense	probably benign	0.00
R2875:Ndst1	UTSW	18	60690047	missense	probably damaging	1.00
R3798:Ndst1	UTSW	18	60713166	missense	possibly damaging	0.94
R3951:Ndst1	UTSW	18	60697139	missense	probably benign	0.12
R3952:Ndst1	UTSW	18	60697139	missense	probably benign	0.12
R4868:Ndst1	UTSW	18	60695476	missense	probably benign	0.07
R4898:Ndst1	UTSW	18	60691987	missense	probably benign	0.12
R4988:Ndst1	UTSW	18	60702933	missense	probably damaging	0.99
R5271:Ndst1	UTSW	18	60705132	missense	probably benign	0.03
R5337:Ndst1	UTSW	18	60690007	missense	probably damaging	1.00
R5467:Ndst1	UTSW	18	60692021	missense	probably benign
R5830:Ndst1	UTSW	18	60703838	missense	probably damaging	1.00
R5968:Ndst1	UTSW	18	60713076	missense	probably benign
R6241:Ndst1	UTSW	18	60703829	missense	probably damaging	0.99
R6422:Ndst1	UTSW	18	60702953	missense	probably benign	0.44
R7099:Ndst1	UTSW	18	60695500	missense	possibly damaging	0.88
R7544:Ndst1	UTSW	18	60697184	missense	probably damaging	1.00
R8918:Ndst1	UTSW	18	60692011	missense	probably benign	0.00
R8951:Ndst1	UTSW	18	60697124	missense	probably benign
R9187:Ndst1	UTSW	18	60691196	missense	probably benign	0.03
R9374:Ndst1	UTSW	18	60712859	missense	probably damaging	0.97
V8831:Ndst1	UTSW	18	60702927	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGACTCACTGTGCCTTGTC -3'
(R):5'- TGAGGGAGCTAAGACTCCAG -3'

Sequencing Primer
(F):5'- CCTGTTTATAGGAATCTCAGCCGAG -3'
(R):5'- CCAGACGGGAAGGGGTTTTC -3'

Posted On

2015-04-17