Mutagenetix > Incidental Mutation

Incidental Mutation 'R3950:Kdm2a'

307909

Institutional Source

Beutler Lab

Gene Symbol

Kdm2a

Ensembl Gene

ENSMUSG00000054611

Gene Name

lysine (K)-specific demethylase 2A

Synonyms

Gm4560, lalina, Fbl7, Jhdm1a, Cxxc8, Fbxl11, 5530401A10Rik

MMRRC Submission

040930-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.961) question?

Stock #

R3950 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

4314419-4398285 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 4343232 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Serine at position 365 (L365S)

Ref Sequence

ENSEMBL: ENSMUSP00000076698 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047898] [ENSMUST00000075856] [ENSMUST00000116571]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000047898
AA Change: L365S

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000047683
Gene: ENSMUSG00000054611
AA Change: L365S

Domain	Start	End	E-Value	Type
low complexity region	23	34	N/A	INTRINSIC
low complexity region	127	138	N/A	INTRINSIC
JmjC	148	316	1.52e-34	SMART
low complexity region	416	433	N/A	INTRINSIC
PDB:2YU2\|A	440	517	1e-35	PDB
Pfam:zf-CXXC	563	609	7.5e-16	PFAM
PHD	619	676	3.25e-4	SMART
low complexity region	848	875	N/A	INTRINSIC
FBOX	892	932	1.58e-2	SMART
low complexity region	987	998	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000075856
AA Change: L365S

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000076698
Gene: ENSMUSG00000054611
AA Change: L365S

Domain	Start	End	E-Value	Type
low complexity region	23	34	N/A	INTRINSIC
low complexity region	127	138	N/A	INTRINSIC
JmjC	148	316	1.52e-34	SMART
low complexity region	416	433	N/A	INTRINSIC
PDB:2YU2\|A	440	517	1e-35	PDB
Pfam:zf-CXXC	563	609	7.5e-16	PFAM
PHD	619	676	3.25e-4	SMART
low complexity region	848	875	N/A	INTRINSIC
FBOX	892	932	1.58e-2	SMART
low complexity region	987	998	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000116571
AA Change: L365S

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000139651
Gene: ENSMUSG00000054611
AA Change: L365S

Domain	Start	End	E-Value	Type
low complexity region	23	34	N/A	INTRINSIC
low complexity region	127	138	N/A	INTRINSIC
JmjC	148	316	5.9e-37	SMART
low complexity region	416	433	N/A	INTRINSIC
PDB:2YU2\|A	440	493	4e-21	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000175777

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbls class and, in addition to an F-box, contains at least six highly degenerated leucine-rich repeats. This family member plays a role in epigenetic silencing. It nucleates at CpG islands and specifically demethylates both mono- and di-methylated lysine-36 of histone H3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a null allele show embryonic lethality, severe growth retardation, reduced neuron proliferation, increased neuron apoptosis, impaired neuron differentiation, small hearts, abnormal cardiac looping and, in some cases, incomplete embryonic turning and neural tube closure defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932414N04Rik	T	C	2: 68,664,403		probably null	Het
Ahnak2	A	T	12: 112,785,789	I186N	probably damaging	Het
Appbp2	A	G	11: 85,194,706	I458T	probably damaging	Het
Arhgef25	T	C	10: 127,185,144	Y291C	probably damaging	Het
Ate1	T	C	7: 130,467,292	Y415C	probably damaging	Het
B4galt4	G	T	16: 38,768,022	A72S	probably benign	Het
C3	T	C	17: 57,225,286	R178G	probably benign	Het
Cdh23	T	C	10: 60,657,326	Y3C	probably benign	Het
Col11a1	T	C	3: 114,121,445		probably null	Het
Col22a1	A	G	15: 71,977,358	F294L	possibly damaging	Het
Dera	A	G	6: 137,837,120	Y100C	probably damaging	Het
Dync2h1	A	T	9: 7,112,061	Y276*	probably null	Het
Eea1	A	T	10: 96,042,134	N1389I	probably damaging	Het
Epha4	A	T	1: 77,399,716	Y509N	probably damaging	Het
Fat3	G	A	9: 15,998,271	S2145F	probably damaging	Het
Fezf1	T	A	6: 23,247,420	K219*	probably null	Het
Fsd1	G	A	17: 55,995,517		probably null	Het
Haspin	A	G	11: 73,136,395	Y623H	probably damaging	Het
Hsd3b1	C	T	3: 98,856,138	V56M	possibly damaging	Het
Hyou1	C	T	9: 44,385,227	T483I	probably damaging	Het
Kdm6b	G	T	11: 69,405,615	P609T	probably damaging	Het
Klhl18	T	A	9: 110,428,902	Y490F	probably damaging	Het
Ky	C	T	9: 102,542,428	Q545*	probably null	Het
L1td1	T	C	4: 98,737,353	L595P	probably benign	Het
Map3k20	T	G	2: 72,438,300	I550M	probably damaging	Het
Mug1	T	A	6: 121,878,530	V941E	probably damaging	Het
Ndst1	T	C	18: 60,697,139	N633S	probably benign	Het
Ninl	A	T	2: 150,952,488	I740K	possibly damaging	Het
Npepl1	A	G	2: 174,121,113	N431D	probably damaging	Het
Olfr1128	T	C	2: 87,545,065	T160A	probably damaging	Het
Pacs2	T	C	12: 113,061,113	S408P	probably damaging	Het
Pard6b	C	T	2: 168,099,194	T367I	probably damaging	Het
Pcdhga7	A	G	18: 37,716,515	E525G	probably damaging	Het
Pctp	A	G	11: 89,987,318	I130T	probably benign	Het
Pcx	C	T	19: 4,617,967	H506Y	probably benign	Het
Pdhx	A	G	2: 103,035,241	S199P	probably damaging	Het
Pdia2	C	A	17: 26,197,616		probably null	Het
Pif1	C	A	9: 65,591,834	N445K	probably damaging	Het
Prickle4	T	C	17: 47,688,582	K349E	probably benign	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Ptpdc1	A	T	13: 48,589,194	M173K	probably damaging	Het
Rb1	A	G	14: 73,262,662	L515P	probably damaging	Het
Rcvrn	A	G	11: 67,700,051	K154E	probably damaging	Het
Ros1	C	T	10: 52,066,388	V2059I	probably damaging	Het
Rtn4ip1	T	A	10: 43,909,897		probably null	Het
Sema5a	T	C	15: 32,689,338	Y1050H	probably damaging	Het
Slc25a28	C	T	19: 43,664,269	V318I	probably benign	Het
Srek1	G	A	13: 103,744,895	R408W	unknown	Het
Synrg	C	T	11: 83,989,815	T444I	probably damaging	Het
Ticrr	T	C	7: 79,682,069	L776S	probably damaging	Het
Tmem127	T	C	2: 127,248,657	L31P	probably damaging	Het
Tmprss15	T	A	16: 79,073,186	T190S	probably benign	Het
Trip10	T	A	17: 57,253,411		probably null	Het
Ttc6	A	G	12: 57,649,506	Y31C	probably damaging	Het
Unc80	A	T	1: 66,622,570	H1718L	possibly damaging	Het
Zbtb38	A	G	9: 96,687,546	F495S	probably damaging	Het
Zfp280d	G	T	9: 72,296,019	Q16H	possibly damaging	Het
Zfp521	A	G	18: 13,846,346	S337P	probably damaging	Het
Zswim9	T	A	7: 13,261,577	T218S	possibly damaging	Het

Other mutations in Kdm2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00334:Kdm2a	APN	19	4356898	missense	possibly damaging	0.94
IGL00679:Kdm2a	APN	19	4326841	missense	probably damaging	1.00
IGL01104:Kdm2a	APN	19	4356738	splice site	probably benign
IGL01161:Kdm2a	APN	19	4319251	missense	probably benign	0.04
IGL01433:Kdm2a	APN	19	4342860	missense	possibly damaging	0.83
IGL01456:Kdm2a	APN	19	4351755	missense	probably damaging	1.00
IGL01467:Kdm2a	APN	19	4324407	missense	probably damaging	0.99
IGL01517:Kdm2a	APN	19	4362061	splice site	probably benign
IGL01528:Kdm2a	APN	19	4343055	missense	probably benign	0.18
IGL02504:Kdm2a	APN	19	4356771	missense	possibly damaging	0.92
IGL02895:Kdm2a	APN	19	4362902	missense	probably damaging	1.00
IGL03109:Kdm2a	APN	19	4329107	missense	probably benign	0.04
IGL03171:Kdm2a	APN	19	4356764	missense	probably damaging	1.00
IGL03256:Kdm2a	APN	19	4345510	unclassified	probably benign
BB009:Kdm2a	UTSW	19	4319156	missense	probably damaging	0.98
BB019:Kdm2a	UTSW	19	4319156	missense	probably damaging	0.98
P0027:Kdm2a	UTSW	19	4343245	splice site	probably benign
PIT4382001:Kdm2a	UTSW	19	4343173	missense	probably benign
R0220:Kdm2a	UTSW	19	4324919	missense	possibly damaging	0.85
R0961:Kdm2a	UTSW	19	4329191	missense	probably benign	0.07
R1662:Kdm2a	UTSW	19	4328212	missense	probably damaging	1.00
R2023:Kdm2a	UTSW	19	4322464	missense	probably damaging	0.98
R2191:Kdm2a	UTSW	19	4356931	splice site	probably null
R2207:Kdm2a	UTSW	19	4362870	missense	probably damaging	1.00
R2351:Kdm2a	UTSW	19	4329126	missense	probably benign	0.02
R2406:Kdm2a	UTSW	19	4322518	missense	probably damaging	1.00
R2882:Kdm2a	UTSW	19	4331184	critical splice donor site	probably null
R3788:Kdm2a	UTSW	19	4351805	missense	probably damaging	0.99
R3792:Kdm2a	UTSW	19	4324512	missense	possibly damaging	0.91
R4235:Kdm2a	UTSW	19	4322521	missense	probably damaging	0.98
R4377:Kdm2a	UTSW	19	4329054	missense	probably benign	0.01
R4466:Kdm2a	UTSW	19	4320300	missense	probably damaging	0.99
R4766:Kdm2a	UTSW	19	4324507	unclassified	probably benign
R4824:Kdm2a	UTSW	19	4362787	missense	probably damaging	1.00
R4838:Kdm2a	UTSW	19	4325026	missense	probably benign	0.41
R5283:Kdm2a	UTSW	19	4331269	missense	probably benign	0.00
R6366:Kdm2a	UTSW	19	4324932	missense	probably benign	0.15
R6368:Kdm2a	UTSW	19	4350317	missense	probably damaging	1.00
R6522:Kdm2a	UTSW	19	4324826	missense	possibly damaging	0.49
R6716:Kdm2a	UTSW	19	4329102	missense	probably damaging	1.00
R6757:Kdm2a	UTSW	19	4319243	missense	probably damaging	0.98
R6912:Kdm2a	UTSW	19	4322501	missense	probably benign	0.06
R6996:Kdm2a	UTSW	19	4345641	missense	probably benign	0.16
R7090:Kdm2a	UTSW	19	4319141	missense	probably damaging	1.00
R7497:Kdm2a	UTSW	19	4324376	missense	probably damaging	1.00
R7542:Kdm2a	UTSW	19	4333830	start gained	probably benign
R7932:Kdm2a	UTSW	19	4319156	missense	probably damaging	0.98
R8199:Kdm2a	UTSW	19	4389026	missense	unknown
R8263:Kdm2a	UTSW	19	4324364	missense	possibly damaging	0.88
R8446:Kdm2a	UTSW	19	4356888	nonsense	probably null
R9158:Kdm2a	UTSW	19	4324687	missense	possibly damaging	0.49
R9303:Kdm2a	UTSW	19	4345578	missense	probably benign	0.01
R9314:Kdm2a	UTSW	19	4322482	missense	probably damaging	1.00
R9351:Kdm2a	UTSW	19	4343113	missense
R9353:Kdm2a	UTSW	19	4343113	missense
R9411:Kdm2a	UTSW	19	4362807	missense	probably damaging	0.99
R9456:Kdm2a	UTSW	19	4343113	missense
R9616:Kdm2a	UTSW	19	4320280	missense	probably damaging	0.99
R9625:Kdm2a	UTSW	19	4343113	missense
RF046:Kdm2a	UTSW	19	4324507	unclassified	probably benign
X0028:Kdm2a	UTSW	19	4320271	missense	possibly damaging	0.77
X0028:Kdm2a	UTSW	19	4348746	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCAGACAAAGTTTTCTTCAGACTTGG -3'
(R):5'- AGCTCTGTGCCTTAACATTTACG -3'

Sequencing Primer
(F):5'- CTTCAGACTTGGAAGACTTCGGC -3'
(R):5'- GGGAATCAAACCTGGATCCTTTGC -3'

Posted On

2015-04-17