Incidental Mutation 'R3951:Ncapd2'
ID307935
Institutional Source Beutler Lab
Gene Symbol Ncapd2
Ensembl Gene ENSMUSG00000038252
Gene Namenon-SMC condensin I complex, subunit D2
Synonyms2810406C15Rik, 2810465G24Rik, CNAP1, CAP-D2
MMRRC Submission 040828-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R3951 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location125168007-125191701 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 125186784 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 78 (K78E)
Ref Sequence ENSEMBL: ENSMUSP00000139445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043848] [ENSMUST00000188762] [ENSMUST00000189959]
Predicted Effect probably benign
Transcript: ENSMUST00000043848
AA Change: K78E

PolyPhen 2 Score 0.189 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000042260
Gene: ENSMUSG00000038252
AA Change: K78E

DomainStartEndE-ValueType
Pfam:Cnd1_N 75 240 1.4e-41 PFAM
low complexity region 461 472 N/A INTRINSIC
low complexity region 936 949 N/A INTRINSIC
Pfam:Cnd1 1058 1224 2.5e-65 PFAM
low complexity region 1329 1345 N/A INTRINSIC
low complexity region 1357 1369 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158992
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186210
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187351
Predicted Effect probably damaging
Transcript: ENSMUST00000188762
AA Change: K78E

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000189959
AA Change: K78E

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139445
Gene: ENSMUSG00000038252
AA Change: K78E

DomainStartEndE-ValueType
Pfam:Cnd1_N 73 162 8.3e-6 PFAM
Meta Mutation Damage Score 0.2725 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik T C 10: 100,615,296 probably benign Het
4932414N04Rik T C 2: 68,664,403 probably null Het
Akr1c18 C T 13: 4,135,285 V283I probably benign Het
Atp2b2 T A 6: 113,760,831 M861L possibly damaging Het
Cdh23 T C 10: 60,657,326 Y3C probably benign Het
Clspn A G 4: 126,576,379 E814G probably damaging Het
Csgalnact1 T C 8: 68,461,262 Q97R probably benign Het
Dera A G 6: 137,837,120 Y100C probably damaging Het
Ect2 A T 3: 27,130,120 D517E probably benign Het
Epha4 A T 1: 77,399,716 Y509N probably damaging Het
Fat2 T C 11: 55,296,382 T1213A probably benign Het
Fkbp8 T A 8: 70,532,661 L275Q probably damaging Het
Gabrb2 A G 11: 42,626,881 Y510C probably damaging Het
Gda T C 19: 21,472,445 T16A probably benign Het
Ggcx G A 6: 72,426,558 G363R probably benign Het
Gm527 T G 12: 64,923,502 probably benign Het
Hoxb2 A G 11: 96,353,175 E204G probably damaging Het
Hsd17b11 G A 5: 103,992,937 probably benign Het
Kat14 T C 2: 144,407,329 probably benign Het
Kif16b C T 2: 142,707,359 V1079I probably benign Het
Klhl29 T A 12: 5,140,660 S112C probably damaging Het
Lpcat2 G T 8: 92,864,903 M58I probably benign Het
Lrrc8d G T 5: 105,814,276 V851F probably benign Het
Ltbp3 T C 19: 5,756,001 V929A probably damaging Het
Map3k20 T G 2: 72,438,300 I550M probably damaging Het
Map3k9 T C 12: 81,722,521 M941V probably benign Het
Myom2 A T 8: 15,084,556 Y453F probably benign Het
Ncor2 G T 5: 125,032,256 D1496E possibly damaging Het
Ndnf T C 6: 65,703,141 Y135H possibly damaging Het
Ndst1 T C 18: 60,697,139 N633S probably benign Het
Nmur2 G C 11: 56,040,225 P220R probably damaging Het
Nsd1 G C 13: 55,268,454 E1438Q probably benign Het
Olfr1043 G T 2: 86,162,618 C110* probably null Het
Olfr1128 T C 2: 87,545,065 T160A probably damaging Het
Olfr1413 T A 1: 92,573,789 M206K possibly damaging Het
Olfr229 A T 9: 39,910,725 R307S probably benign Het
Pom121l2 T G 13: 21,982,128 S190A probably damaging Het
Prpmp5 G A 6: 132,312,694 P56S unknown Het
Rtn4ip1 T A 10: 43,909,897 probably null Het
Scarb1 A C 5: 125,287,411 C85G probably damaging Het
Sh2d4b A G 14: 40,872,546 I159T probably damaging Het
Sntg1 C T 1: 8,782,901 probably benign Het
Sos1 G A 17: 80,424,181 T630I probably damaging Het
Spata7 T A 12: 98,669,473 D517E probably damaging Het
Tcaf1 T C 6: 42,679,059 T328A probably benign Het
Ticrr T C 7: 79,682,069 L776S probably damaging Het
Trpc2 T A 7: 102,093,574 M597K probably damaging Het
Ttc37 T G 13: 76,130,219 L551V probably damaging Het
Tubb3 C A 8: 123,421,264 T312N probably damaging Het
Ubr4 G A 4: 139,393,094 V277M probably damaging Het
Uhrf2 G A 19: 30,079,861 R473Q probably damaging Het
Vmn2r43 T A 7: 8,255,320 H298L probably benign Het
Other mutations in Ncapd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00477:Ncapd2 APN 6 125173425 missense probably benign 0.05
IGL00960:Ncapd2 APN 6 125173848 missense probably benign
IGL01307:Ncapd2 APN 6 125168619 missense possibly damaging 0.56
IGL01612:Ncapd2 APN 6 125177872 missense probably benign 0.01
IGL01903:Ncapd2 APN 6 125177460 missense probably benign
IGL01987:Ncapd2 APN 6 125185841 splice site probably benign
IGL01998:Ncapd2 APN 6 125173115 missense probably benign 0.18
IGL01998:Ncapd2 APN 6 125169933 missense probably damaging 1.00
IGL02329:Ncapd2 APN 6 125189818 missense probably damaging 0.99
IGL02550:Ncapd2 APN 6 125177447 missense probably benign
IGL02662:Ncapd2 APN 6 125176731 missense probably damaging 1.00
IGL02817:Ncapd2 APN 6 125170914 critical splice donor site probably null
IGL03121:Ncapd2 APN 6 125173612 missense probably benign 0.00
IGL03206:Ncapd2 APN 6 125171697 missense possibly damaging 0.85
FR4548:Ncapd2 UTSW 6 125173596 critical splice donor site probably benign
PIT4305001:Ncapd2 UTSW 6 125184027 nonsense probably null
R0486:Ncapd2 UTSW 6 125184027 nonsense probably null
R0635:Ncapd2 UTSW 6 125173036 missense probably benign 0.00
R0699:Ncapd2 UTSW 6 125169880 missense probably benign
R0746:Ncapd2 UTSW 6 125174264 missense possibly damaging 0.50
R0893:Ncapd2 UTSW 6 125173482 missense probably benign
R1385:Ncapd2 UTSW 6 125173115 missense probably benign 0.18
R1513:Ncapd2 UTSW 6 125170992 missense probably damaging 1.00
R1601:Ncapd2 UTSW 6 125185772 missense probably damaging 1.00
R1698:Ncapd2 UTSW 6 125168590 missense probably null 0.39
R2030:Ncapd2 UTSW 6 125176715 missense possibly damaging 0.95
R2035:Ncapd2 UTSW 6 125184528 missense probably benign 0.17
R2359:Ncapd2 UTSW 6 125179416 unclassified probably benign
R3952:Ncapd2 UTSW 6 125186784 missense probably damaging 0.98
R3953:Ncapd2 UTSW 6 125170734 missense probably damaging 0.96
R4623:Ncapd2 UTSW 6 125173609 missense probably benign 0.04
R4630:Ncapd2 UTSW 6 125179233 splice site probably null
R4667:Ncapd2 UTSW 6 125184518 missense possibly damaging 0.69
R4769:Ncapd2 UTSW 6 125185745 missense probably damaging 1.00
R4936:Ncapd2 UTSW 6 125169840 missense probably benign 0.18
R5130:Ncapd2 UTSW 6 125169924 missense possibly damaging 0.90
R5465:Ncapd2 UTSW 6 125176783 missense probably damaging 0.98
R5806:Ncapd2 UTSW 6 125181154 missense probably damaging 0.98
R5823:Ncapd2 UTSW 6 125168700 missense probably benign 0.00
R5888:Ncapd2 UTSW 6 125187089 missense probably damaging 1.00
R5940:Ncapd2 UTSW 6 125168869 missense probably benign
R6198:Ncapd2 UTSW 6 125179323 nonsense probably null
R6406:Ncapd2 UTSW 6 125173878 missense probably benign
R6652:Ncapd2 UTSW 6 125186270 missense probably benign 0.13
R6959:Ncapd2 UTSW 6 125168920 missense probably benign
R6977:Ncapd2 UTSW 6 125171509 missense probably damaging 1.00
R6982:Ncapd2 UTSW 6 125176736 missense probably damaging 0.96
R7143:Ncapd2 UTSW 6 125179561 missense probably benign
R7144:Ncapd2 UTSW 6 125176670 missense probably benign 0.11
R7186:Ncapd2 UTSW 6 125186156 missense possibly damaging 0.89
R7203:Ncapd2 UTSW 6 125184328 missense possibly damaging 0.58
R7384:Ncapd2 UTSW 6 125173401 missense probably benign
R8039:Ncapd2 UTSW 6 125181026 missense probably damaging 0.98
R8047:Ncapd2 UTSW 6 125189799 missense probably damaging 0.98
R8048:Ncapd2 UTSW 6 125179698 nonsense probably null
R8056:Ncapd2 UTSW 6 125171043 missense probably damaging 1.00
RF045:Ncapd2 UTSW 6 125179236 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GCACATTACTCTGTATCGACCAC -3'
(R):5'- ACTTGGTTCTGGGTACTGACATC -3'

Sequencing Primer
(F):5'- TCTGTATCGACCACCAAGATTACAG -3'
(R):5'- CTGGGTACTGACATCCATAGTGAGC -3'
Posted On2015-04-17