Incidental Mutation 'R3951:Ticrr'
ID 307939
Institutional Source Beutler Lab
Gene Symbol Ticrr
Ensembl Gene ENSMUSG00000046591
Gene Name TOPBP1-interacting checkpoint and replication regulator
Synonyms 5730590G19Rik
MMRRC Submission 040828-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.949) question?
Stock # R3951 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 79309944-79347896 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 79331817 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Serine at position 776 (L776S)
Ref Sequence ENSEMBL: ENSMUSP00000145735 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035977] [ENSMUST00000206017] [ENSMUST00000206591] [ENSMUST00000206622]
AlphaFold Q8BQ33
Predicted Effect probably damaging
Transcript: ENSMUST00000035977
AA Change: L776S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000041377
Gene: ENSMUSG00000046591
AA Change: L776S

DomainStartEndE-ValueType
low complexity region 23 31 N/A INTRINSIC
Pfam:Treslin_N 211 1005 N/A PFAM
low complexity region 1186 1197 N/A INTRINSIC
low complexity region 1220 1235 N/A INTRINSIC
low complexity region 1339 1359 N/A INTRINSIC
low complexity region 1472 1480 N/A INTRINSIC
low complexity region 1496 1514 N/A INTRINSIC
low complexity region 1630 1643 N/A INTRINSIC
low complexity region 1694 1707 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206017
Predicted Effect probably damaging
Transcript: ENSMUST00000206591
AA Change: L776S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000206622
Meta Mutation Damage Score 0.4235 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Treslin is involved in the initiation of DNA replication (Kumagai et al., 2010 [PubMed 20116089]).[supplied by OMIM, Apr 2010]
PHENOTYPE: Mice homozygous for an ENU-induced allele are mostly hairless, with only a light patch of hair around the face and tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik T C 10: 100,451,158 (GRCm39) probably benign Het
4932414N04Rik T C 2: 68,494,747 (GRCm39) probably null Het
Akr1c18 C T 13: 4,185,284 (GRCm39) V283I probably benign Het
Atp2b2 T A 6: 113,737,792 (GRCm39) M861L possibly damaging Het
Cdh23 T C 10: 60,493,105 (GRCm39) Y3C probably benign Het
Clspn A G 4: 126,470,172 (GRCm39) E814G probably damaging Het
Csgalnact1 T C 8: 68,913,914 (GRCm39) Q97R probably benign Het
Dera A G 6: 137,814,118 (GRCm39) Y100C probably damaging Het
Ect2 A T 3: 27,184,269 (GRCm39) D517E probably benign Het
Epha4 A T 1: 77,376,353 (GRCm39) Y509N probably damaging Het
Fat2 T C 11: 55,187,208 (GRCm39) T1213A probably benign Het
Fkbp8 T A 8: 70,985,311 (GRCm39) L275Q probably damaging Het
Gabrb2 A G 11: 42,517,708 (GRCm39) Y510C probably damaging Het
Gda T C 19: 21,449,809 (GRCm39) T16A probably benign Het
Ggcx G A 6: 72,403,541 (GRCm39) G363R probably benign Het
Gm527 T G 12: 64,970,276 (GRCm39) probably benign Het
Hoxb2 A G 11: 96,244,001 (GRCm39) E204G probably damaging Het
Hsd17b11 G A 5: 104,140,803 (GRCm39) probably benign Het
Kat14 T C 2: 144,249,249 (GRCm39) probably benign Het
Kif16b C T 2: 142,549,279 (GRCm39) V1079I probably benign Het
Klhl29 T A 12: 5,190,660 (GRCm39) S112C probably damaging Het
Lpcat2 G T 8: 93,591,531 (GRCm39) M58I probably benign Het
Lrrc8d G T 5: 105,962,142 (GRCm39) V851F probably benign Het
Ltbp3 T C 19: 5,806,029 (GRCm39) V929A probably damaging Het
Map3k20 T G 2: 72,268,644 (GRCm39) I550M probably damaging Het
Map3k9 T C 12: 81,769,295 (GRCm39) M941V probably benign Het
Myom2 A T 8: 15,134,556 (GRCm39) Y453F probably benign Het
Ncapd2 T C 6: 125,163,747 (GRCm39) K78E probably damaging Het
Ncor2 G T 5: 125,109,320 (GRCm39) D1496E possibly damaging Het
Ndnf T C 6: 65,680,125 (GRCm39) Y135H possibly damaging Het
Ndst1 T C 18: 60,830,211 (GRCm39) N633S probably benign Het
Nmur2 G C 11: 55,931,051 (GRCm39) P220R probably damaging Het
Nsd1 G C 13: 55,416,267 (GRCm39) E1438Q probably benign Het
Or5al7 G T 2: 85,992,962 (GRCm39) C110* probably null Het
Or5w10 T C 2: 87,375,409 (GRCm39) T160A probably damaging Het
Or8g2 A T 9: 39,822,021 (GRCm39) R307S probably benign Het
Or9s23 T A 1: 92,501,511 (GRCm39) M206K possibly damaging Het
Pom121l2 T G 13: 22,166,298 (GRCm39) S190A probably damaging Het
Prb1b G A 6: 132,289,657 (GRCm39) P56S unknown Het
Rtn4ip1 T A 10: 43,785,893 (GRCm39) probably null Het
Scarb1 A C 5: 125,364,475 (GRCm39) C85G probably damaging Het
Sh2d4b A G 14: 40,594,503 (GRCm39) I159T probably damaging Het
Skic3 T G 13: 76,278,338 (GRCm39) L551V probably damaging Het
Sntg1 C T 1: 8,853,125 (GRCm39) probably benign Het
Sos1 G A 17: 80,731,610 (GRCm39) T630I probably damaging Het
Spata7 T A 12: 98,635,732 (GRCm39) D517E probably damaging Het
Tcaf1 T C 6: 42,655,993 (GRCm39) T328A probably benign Het
Trpc2 T A 7: 101,742,781 (GRCm39) M597K probably damaging Het
Tubb3 C A 8: 124,148,003 (GRCm39) T312N probably damaging Het
Ubr4 G A 4: 139,120,405 (GRCm39) V277M probably damaging Het
Uhrf2 G A 19: 30,057,261 (GRCm39) R473Q probably damaging Het
Vmn2r43 T A 7: 8,258,319 (GRCm39) H298L probably benign Het
Other mutations in Ticrr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Ticrr APN 7 79,327,031 (GRCm39) missense probably damaging 1.00
IGL00596:Ticrr APN 7 79,327,041 (GRCm39) missense probably damaging 1.00
IGL01327:Ticrr APN 7 79,344,209 (GRCm39) missense probably benign 0.00
IGL01525:Ticrr APN 7 79,332,197 (GRCm39) missense probably damaging 1.00
IGL01565:Ticrr APN 7 79,344,296 (GRCm39) missense probably benign
IGL01936:Ticrr APN 7 79,344,297 (GRCm39) missense probably benign 0.11
IGL02160:Ticrr APN 7 79,343,767 (GRCm39) missense probably benign 0.29
IGL02246:Ticrr APN 7 79,325,076 (GRCm39) missense probably damaging 1.00
IGL02487:Ticrr APN 7 79,332,769 (GRCm39) missense possibly damaging 0.86
IGL02593:Ticrr APN 7 79,345,214 (GRCm39) missense probably damaging 0.99
IGL02970:Ticrr APN 7 79,344,919 (GRCm39) missense probably benign 0.01
FR4304:Ticrr UTSW 7 79,344,059 (GRCm39) intron probably benign
PIT4305001:Ticrr UTSW 7 79,328,771 (GRCm39) missense possibly damaging 0.95
PIT4791001:Ticrr UTSW 7 79,319,386 (GRCm39) missense possibly damaging 0.92
R0016:Ticrr UTSW 7 79,343,540 (GRCm39) missense probably benign 0.01
R0062:Ticrr UTSW 7 79,317,654 (GRCm39) missense probably benign 0.01
R0062:Ticrr UTSW 7 79,317,654 (GRCm39) missense probably benign 0.01
R0067:Ticrr UTSW 7 79,327,158 (GRCm39) missense probably damaging 1.00
R0067:Ticrr UTSW 7 79,327,158 (GRCm39) missense probably damaging 1.00
R0362:Ticrr UTSW 7 79,327,088 (GRCm39) missense probably damaging 1.00
R0482:Ticrr UTSW 7 79,344,236 (GRCm39) missense probably damaging 0.99
R0595:Ticrr UTSW 7 79,345,311 (GRCm39) missense possibly damaging 0.94
R1118:Ticrr UTSW 7 79,343,701 (GRCm39) missense probably benign 0.23
R1119:Ticrr UTSW 7 79,343,701 (GRCm39) missense probably benign 0.23
R1572:Ticrr UTSW 7 79,331,572 (GRCm39) missense probably damaging 1.00
R1658:Ticrr UTSW 7 79,345,297 (GRCm39) missense possibly damaging 0.57
R1757:Ticrr UTSW 7 79,328,794 (GRCm39) nonsense probably null
R1757:Ticrr UTSW 7 79,325,071 (GRCm39) missense probably damaging 0.99
R1862:Ticrr UTSW 7 79,344,955 (GRCm39) missense probably damaging 1.00
R1869:Ticrr UTSW 7 79,328,883 (GRCm39) missense probably damaging 1.00
R1938:Ticrr UTSW 7 79,325,142 (GRCm39) missense probably damaging 0.98
R1966:Ticrr UTSW 7 79,344,483 (GRCm39) nonsense probably null
R2006:Ticrr UTSW 7 79,343,821 (GRCm39) missense possibly damaging 0.93
R2178:Ticrr UTSW 7 79,315,433 (GRCm39) missense probably benign 0.12
R3404:Ticrr UTSW 7 79,344,539 (GRCm39) missense probably benign 0.06
R3405:Ticrr UTSW 7 79,344,539 (GRCm39) missense probably benign 0.06
R3941:Ticrr UTSW 7 79,343,445 (GRCm39) intron probably benign
R3950:Ticrr UTSW 7 79,331,817 (GRCm39) missense probably damaging 1.00
R3952:Ticrr UTSW 7 79,331,817 (GRCm39) missense probably damaging 1.00
R4967:Ticrr UTSW 7 79,310,158 (GRCm39) missense probably damaging 0.99
R4972:Ticrr UTSW 7 79,319,416 (GRCm39) missense probably damaging 0.98
R5259:Ticrr UTSW 7 79,344,471 (GRCm39) missense probably benign 0.01
R5272:Ticrr UTSW 7 79,319,353 (GRCm39) missense probably benign 0.44
R5374:Ticrr UTSW 7 79,340,690 (GRCm39) nonsense probably null
R5480:Ticrr UTSW 7 79,310,557 (GRCm39) missense probably damaging 1.00
R5568:Ticrr UTSW 7 79,345,044 (GRCm39) nonsense probably null
R5568:Ticrr UTSW 7 79,339,715 (GRCm39) critical splice donor site probably null
R5588:Ticrr UTSW 7 79,328,853 (GRCm39) missense probably damaging 1.00
R5698:Ticrr UTSW 7 79,328,881 (GRCm39) missense probably benign
R5879:Ticrr UTSW 7 79,346,438 (GRCm39) missense probably benign 0.12
R5980:Ticrr UTSW 7 79,310,703 (GRCm39) missense probably damaging 0.99
R6128:Ticrr UTSW 7 79,343,716 (GRCm39) missense probably damaging 1.00
R6277:Ticrr UTSW 7 79,344,444 (GRCm39) missense probably benign 0.00
R6335:Ticrr UTSW 7 79,344,031 (GRCm39) splice site probably null
R6866:Ticrr UTSW 7 79,343,705 (GRCm39) missense possibly damaging 0.47
R6905:Ticrr UTSW 7 79,315,598 (GRCm39) missense probably benign 0.00
R6923:Ticrr UTSW 7 79,341,601 (GRCm39) missense probably damaging 0.98
R6962:Ticrr UTSW 7 79,315,645 (GRCm39) missense possibly damaging 0.84
R7232:Ticrr UTSW 7 79,343,490 (GRCm39) missense probably damaging 0.96
R7285:Ticrr UTSW 7 79,310,610 (GRCm39) missense possibly damaging 0.93
R7385:Ticrr UTSW 7 79,341,597 (GRCm39) missense possibly damaging 0.93
R7426:Ticrr UTSW 7 79,343,734 (GRCm39) missense probably benign
R7583:Ticrr UTSW 7 79,346,487 (GRCm39) nonsense probably null
R7749:Ticrr UTSW 7 79,328,844 (GRCm39) missense possibly damaging 0.94
R7863:Ticrr UTSW 7 79,331,760 (GRCm39) missense possibly damaging 0.92
R7899:Ticrr UTSW 7 79,319,233 (GRCm39) missense probably benign 0.23
R7935:Ticrr UTSW 7 79,331,584 (GRCm39) missense probably damaging 0.99
R8005:Ticrr UTSW 7 79,343,796 (GRCm39) missense probably damaging 0.98
R8080:Ticrr UTSW 7 79,334,012 (GRCm39) splice site probably null
R8181:Ticrr UTSW 7 79,310,728 (GRCm39) missense possibly damaging 0.92
R8349:Ticrr UTSW 7 79,344,428 (GRCm39) missense probably benign 0.27
R8410:Ticrr UTSW 7 79,317,423 (GRCm39) missense probably damaging 0.98
R8449:Ticrr UTSW 7 79,344,428 (GRCm39) missense probably benign 0.27
R9073:Ticrr UTSW 7 79,317,679 (GRCm39) missense probably benign 0.01
R9090:Ticrr UTSW 7 79,310,604 (GRCm39) missense possibly damaging 0.85
R9271:Ticrr UTSW 7 79,310,604 (GRCm39) missense possibly damaging 0.85
R9287:Ticrr UTSW 7 79,343,516 (GRCm39) missense possibly damaging 0.89
R9368:Ticrr UTSW 7 79,330,735 (GRCm39) missense probably damaging 0.99
R9469:Ticrr UTSW 7 79,344,511 (GRCm39) missense probably benign 0.03
R9502:Ticrr UTSW 7 79,343,597 (GRCm39) missense probably benign
R9614:Ticrr UTSW 7 79,345,754 (GRCm39) missense probably damaging 1.00
R9761:Ticrr UTSW 7 79,345,313 (GRCm39) missense probably damaging 1.00
R9779:Ticrr UTSW 7 79,328,802 (GRCm39) missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- GGTGCCAGCTTCAGGTATTTC -3'
(R):5'- GGGGATGGAGCCAATATACCTG -3'

Sequencing Primer
(F):5'- AGATGTGTGAGCAGTGCCC -3'
(R):5'- TGGAGCCAATATACCTGTGGAATG -3'
Posted On 2015-04-17