Mutagenetix > Incidental Mutations

Incidental Mutation 'R3951:Gabrb2'

307952

Institutional Source

Beutler Lab

Gene Symbol

Gabrb2

Ensembl Gene

ENSMUSG00000007653

Gene Name

gamma-aminobutyric acid (GABA) A receptor, subunit beta 2

Synonyms

C030002O17Rik, C030021G16Rik, Gabrb-2

MMRRC Submission

040828-MU

Accession Numbers

Genbank: NM_008070

Is this an essential gene?

Possibly non essential (E-score: 0.370) question?

Stock #

R3951 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

42419757-42629028 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 42626881 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 510 (Y510C)

Ref Sequence

ENSEMBL: ENSMUSP00000141868 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000007797] [ENSMUST00000192403]

Predicted Effect

probably damaging
Transcript: ENSMUST00000007797
AA Change: Y472C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000007797
Gene: ENSMUSG00000007653
AA Change: Y472C

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:Neur_chan_LBD	36	242	8.7e-52	PFAM
Pfam:Neur_chan_memb	249	469	7.5e-49	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000192403
AA Change: Y510C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000141868
Gene: ENSMUSG00000007653
AA Change: Y510C

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:Neur_chan_LBD	36	242	1.1e-54	PFAM
Pfam:Neur_chan_memb	249	507	6.6e-55	PFAM

Meta Mutation Damage Score

0.8611

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

100% (55/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gamma-aminobutyric acid (GABA) A receptor is a multisubunit chloride channel that mediates the fastest inhibitory synaptic transmission in the central nervous system. This gene encodes GABA A receptor, beta 2 subunit. It is mapped to chromosome 5q34 in a cluster comprised of genes encoding alpha 1 and gamma 2 subunits of the GABA A receptor. Alternative splicing of this gene generates 2 transcript variants, differing by a 114 bp insertion. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show hyperactivity and abnormal GABA-mediated receptor currents. Homozygotes for a derivative of this allele show a sexually dimorphic cochlear phenotype associated with OHC dysfunction. Homozygotes for a knock-in allele show altered behavioral response to etomidate. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Targeted, other(1) Gene trapped(1)

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017N19Rik	T	C	10: 100,615,296		probably benign	Het
4932414N04Rik	T	C	2: 68,664,403		probably null	Het
Akr1c18	C	T	13: 4,135,285	V283I	probably benign	Het
Atp2b2	T	A	6: 113,760,831	M861L	possibly damaging	Het
Cdh23	T	C	10: 60,657,326	Y3C	probably benign	Het
Clspn	A	G	4: 126,576,379	E814G	probably damaging	Het
Csgalnact1	T	C	8: 68,461,262	Q97R	probably benign	Het
Dera	A	G	6: 137,837,120	Y100C	probably damaging	Het
Ect2	A	T	3: 27,130,120	D517E	probably benign	Het
Epha4	A	T	1: 77,399,716	Y509N	probably damaging	Het
Fat2	T	C	11: 55,296,382	T1213A	probably benign	Het
Fkbp8	T	A	8: 70,532,661	L275Q	probably damaging	Het
Gda	T	C	19: 21,472,445	T16A	probably benign	Het
Ggcx	G	A	6: 72,426,558	G363R	probably benign	Het
Gm527	T	G	12: 64,923,502		probably benign	Het
Hoxb2	A	G	11: 96,353,175	E204G	probably damaging	Het
Hsd17b11	G	A	5: 103,992,937		probably benign	Het
Kat14	T	C	2: 144,407,329		probably benign	Het
Kif16b	C	T	2: 142,707,359	V1079I	probably benign	Het
Klhl29	T	A	12: 5,140,660	S112C	probably damaging	Het
Lpcat2	G	T	8: 92,864,903	M58I	probably benign	Het
Lrrc8d	G	T	5: 105,814,276	V851F	probably benign	Het
Ltbp3	T	C	19: 5,756,001	V929A	probably damaging	Het
Map3k20	T	G	2: 72,438,300	I550M	probably damaging	Het
Map3k9	T	C	12: 81,722,521	M941V	probably benign	Het
Myom2	A	T	8: 15,084,556	Y453F	probably benign	Het
Ncapd2	T	C	6: 125,186,784	K78E	probably damaging	Het
Ncor2	G	T	5: 125,032,256	D1496E	possibly damaging	Het
Ndnf	T	C	6: 65,703,141	Y135H	possibly damaging	Het
Ndst1	T	C	18: 60,697,139	N633S	probably benign	Het
Nmur2	G	C	11: 56,040,225	P220R	probably damaging	Het
Nsd1	G	C	13: 55,268,454	E1438Q	probably benign	Het
Olfr1043	G	T	2: 86,162,618	C110*	probably null	Het
Olfr1128	T	C	2: 87,545,065	T160A	probably damaging	Het
Olfr1413	T	A	1: 92,573,789	M206K	possibly damaging	Het
Olfr229	A	T	9: 39,910,725	R307S	probably benign	Het
Pom121l2	T	G	13: 21,982,128	S190A	probably damaging	Het
Prpmp5	G	A	6: 132,312,694	P56S	unknown	Het
Rtn4ip1	T	A	10: 43,909,897		probably null	Het
Scarb1	A	C	5: 125,287,411	C85G	probably damaging	Het
Sh2d4b	A	G	14: 40,872,546	I159T	probably damaging	Het
Sntg1	C	T	1: 8,782,901		probably benign	Het
Sos1	G	A	17: 80,424,181	T630I	probably damaging	Het
Spata7	T	A	12: 98,669,473	D517E	probably damaging	Het
Tcaf1	T	C	6: 42,679,059	T328A	probably benign	Het
Ticrr	T	C	7: 79,682,069	L776S	probably damaging	Het
Trpc2	T	A	7: 102,093,574	M597K	probably damaging	Het
Ttc37	T	G	13: 76,130,219	L551V	probably damaging	Het
Tubb3	C	A	8: 123,421,264	T312N	probably damaging	Het
Ubr4	G	A	4: 139,393,094	V277M	probably damaging	Het
Uhrf2	G	A	19: 30,079,861	R473Q	probably damaging	Het
Vmn2r43	T	A	7: 8,255,320	H298L	probably benign	Het

Other mutations in Gabrb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02275:Gabrb2	APN	11	42591894	missense	probably benign	0.00
IGL02666:Gabrb2	APN	11	42529495	critical splice donor site	probably null
IGL02983:Gabrb2	APN	11	42421400	missense	probably benign	0.00
IGL03357:Gabrb2	APN	11	42591944	missense	probably damaging	1.00
H2330:Gabrb2	UTSW	11	42421431	splice site	probably benign
R0049:Gabrb2	UTSW	11	42593847	missense	probably damaging	1.00
R0049:Gabrb2	UTSW	11	42593847	missense	probably damaging	1.00
R0100:Gabrb2	UTSW	11	42487314	missense	probably damaging	1.00
R1423:Gabrb2	UTSW	11	42529471	missense	probably damaging	1.00
R1526:Gabrb2	UTSW	11	42591888	missense	possibly damaging	0.83
R1856:Gabrb2	UTSW	11	42626713	missense	probably benign	0.01
R1898:Gabrb2	UTSW	11	42593832	missense	possibly damaging	0.51
R2184:Gabrb2	UTSW	11	42421428	critical splice donor site	probably null
R2371:Gabrb2	UTSW	11	42591864	missense	probably damaging	1.00
R2915:Gabrb2	UTSW	11	42591907	missense	probably benign
R2993:Gabrb2	UTSW	11	42597649	missense	probably damaging	0.99
R4167:Gabrb2	UTSW	11	42421328	unclassified	probably benign
R4168:Gabrb2	UTSW	11	42421328	unclassified	probably benign
R4497:Gabrb2	UTSW	11	42597694	missense	probably benign	0.05
R4572:Gabrb2	UTSW	11	42593917	missense	possibly damaging	0.46
R4784:Gabrb2	UTSW	11	42597642	missense	probably damaging	1.00
R4792:Gabrb2	UTSW	11	42529503	splice site	probably benign
R5345:Gabrb2	UTSW	11	42626809	missense	possibly damaging	0.54
R5346:Gabrb2	UTSW	11	42421389	missense	probably benign
R5575:Gabrb2	UTSW	11	42529538	intron	probably benign
R5701:Gabrb2	UTSW	11	42487374	missense	probably damaging	1.00
R5801:Gabrb2	UTSW	11	42421389	missense	probably benign	0.00
R5965:Gabrb2	UTSW	11	42626869	missense	probably damaging	1.00
R6738:Gabrb2	UTSW	11	42593931	missense	possibly damaging	0.95
R6930:Gabrb2	UTSW	11	42597613	missense	probably damaging	1.00
R7011:Gabrb2	UTSW	11	42626661	missense	possibly damaging	0.76
R7045:Gabrb2	UTSW	11	42593931	missense	probably damaging	1.00
R7615:Gabrb2	UTSW	11	42626742	missense	probably benign	0.06
R7653:Gabrb2	UTSW	11	42487212	missense	probably damaging	1.00
R7866:Gabrb2	UTSW	11	42487223	nonsense	probably null
R7949:Gabrb2	UTSW	11	42487223	nonsense	probably null
RF008:Gabrb2	UTSW	11	42626878	missense	probably damaging	1.00
X0020:Gabrb2	UTSW	11	42422646	missense	probably benign	0.26

Predicted Primers

PCR Primer
(F):5'- ATAGTTTTGGCCGCAACGC -3'
(R):5'- CATTGTAACTGGAAAACCGCG -3'

Sequencing Primer
(F):5'- GCTCTGGAGCGACATGTG -3'
(R):5'- CGCGAGGACCTTAGTGTATTCC -3'

Posted On

2015-04-17