Incidental Mutation 'R3951:Hoxb2'
ID 307955
Institutional Source Beutler Lab
Gene Symbol Hoxb2
Ensembl Gene ENSMUSG00000075588
Gene Name homeobox B2
Synonyms Hoxbes2, Hox-2.8
MMRRC Submission 040828-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.854) question?
Stock # R3951 (G1)
Quality Score 143
Status Validated
Chromosome 11
Chromosomal Location 96350525-96354012 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 96353175 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 204 (E204G)
Ref Sequence ENSEMBL: ENSMUSP00000098092 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100523]
AlphaFold P0C1T1
Predicted Effect probably damaging
Transcript: ENSMUST00000100523
AA Change: E204G

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000098092
Gene: ENSMUSG00000075588
AA Change: E204G

DomainStartEndE-ValueType
low complexity region 76 94 N/A INTRINSIC
low complexity region 99 118 N/A INTRINSIC
HOX 141 203 2.54e-28 SMART
low complexity region 204 213 N/A INTRINSIC
low complexity region 317 330 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147410
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182030
Meta Mutation Damage Score 0.0936 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Antp homeobox family and encodes a nuclear protein with a homeobox DNA-binding domain. It is included in a cluster of homeobox B genes located on chromosome 17. The encoded protein functions as a sequence-specific transcription factor that is involved in development. Increased expression of this gene is associated with pancreatic cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a reporter allele die neonatally with altered segmental identity and abnormal migration of motor neurons in the hindbrain. Mice homozygous for null alleles can exhibit partial postnatal lethality, narrow face, runting, absent facial motor nuclei, and facial nerve/muscle defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik T C 10: 100,615,296 probably benign Het
4932414N04Rik T C 2: 68,664,403 probably null Het
Akr1c18 C T 13: 4,135,285 V283I probably benign Het
Atp2b2 T A 6: 113,760,831 M861L possibly damaging Het
Cdh23 T C 10: 60,657,326 Y3C probably benign Het
Clspn A G 4: 126,576,379 E814G probably damaging Het
Csgalnact1 T C 8: 68,461,262 Q97R probably benign Het
Dera A G 6: 137,837,120 Y100C probably damaging Het
Ect2 A T 3: 27,130,120 D517E probably benign Het
Epha4 A T 1: 77,399,716 Y509N probably damaging Het
Fat2 T C 11: 55,296,382 T1213A probably benign Het
Fkbp8 T A 8: 70,532,661 L275Q probably damaging Het
Gabrb2 A G 11: 42,626,881 Y510C probably damaging Het
Gda T C 19: 21,472,445 T16A probably benign Het
Ggcx G A 6: 72,426,558 G363R probably benign Het
Gm527 T G 12: 64,923,502 probably benign Het
Hsd17b11 G A 5: 103,992,937 probably benign Het
Kat14 T C 2: 144,407,329 probably benign Het
Kif16b C T 2: 142,707,359 V1079I probably benign Het
Klhl29 T A 12: 5,140,660 S112C probably damaging Het
Lpcat2 G T 8: 92,864,903 M58I probably benign Het
Lrrc8d G T 5: 105,814,276 V851F probably benign Het
Ltbp3 T C 19: 5,756,001 V929A probably damaging Het
Map3k20 T G 2: 72,438,300 I550M probably damaging Het
Map3k9 T C 12: 81,722,521 M941V probably benign Het
Myom2 A T 8: 15,084,556 Y453F probably benign Het
Ncapd2 T C 6: 125,186,784 K78E probably damaging Het
Ncor2 G T 5: 125,032,256 D1496E possibly damaging Het
Ndnf T C 6: 65,703,141 Y135H possibly damaging Het
Ndst1 T C 18: 60,697,139 N633S probably benign Het
Nmur2 G C 11: 56,040,225 P220R probably damaging Het
Nsd1 G C 13: 55,268,454 E1438Q probably benign Het
Olfr1043 G T 2: 86,162,618 C110* probably null Het
Olfr1128 T C 2: 87,545,065 T160A probably damaging Het
Olfr1413 T A 1: 92,573,789 M206K possibly damaging Het
Olfr229 A T 9: 39,910,725 R307S probably benign Het
Pom121l2 T G 13: 21,982,128 S190A probably damaging Het
Prpmp5 G A 6: 132,312,694 P56S unknown Het
Rtn4ip1 T A 10: 43,909,897 probably null Het
Scarb1 A C 5: 125,287,411 C85G probably damaging Het
Sh2d4b A G 14: 40,872,546 I159T probably damaging Het
Sntg1 C T 1: 8,782,901 probably benign Het
Sos1 G A 17: 80,424,181 T630I probably damaging Het
Spata7 T A 12: 98,669,473 D517E probably damaging Het
Tcaf1 T C 6: 42,679,059 T328A probably benign Het
Ticrr T C 7: 79,682,069 L776S probably damaging Het
Trpc2 T A 7: 102,093,574 M597K probably damaging Het
Ttc37 T G 13: 76,130,219 L551V probably damaging Het
Tubb3 C A 8: 123,421,264 T312N probably damaging Het
Ubr4 G A 4: 139,393,094 V277M probably damaging Het
Uhrf2 G A 19: 30,079,861 R473Q probably damaging Het
Vmn2r43 T A 7: 8,255,320 H298L probably benign Het
Other mutations in Hoxb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02992:Hoxb2 APN 11 96353084 missense probably damaging 1.00
R6950:Hoxb2 UTSW 11 96351901 missense probably benign 0.34
R7103:Hoxb2 UTSW 11 96353621 missense possibly damaging 0.85
R7673:Hoxb2 UTSW 11 96353457 missense possibly damaging 0.83
R8784:Hoxb2 UTSW 11 96351910 missense possibly damaging 0.62
R9166:Hoxb2 UTSW 11 96353513 missense probably damaging 0.98
Z1177:Hoxb2 UTSW 11 96351989 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGATAACATAGGGGTGCTTCC -3'
(R):5'- AGAAAAGGCGAATCCTGCCG -3'

Sequencing Primer
(F):5'- ATTGCCAGAATGCGGCG -3'
(R):5'- ACACTCTCCAGGGTGGTG -3'
Posted On 2015-04-17