Mutagenetix > Incidental Mutations

Incidental Mutation 'R3951:Hoxb2'

307955

Institutional Source

Beutler Lab

Gene Symbol

Hoxb2

Ensembl Gene

ENSMUSG00000075588

Gene Name

homeobox B2

Synonyms

Hoxbes2, Hox-2.8

MMRRC Submission

040828-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.583) question?

Stock #

R3951 (G1)

Quality Score

143

Status

Validated

Chromosome

Chromosomal Location

96350525-96354012 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 96353175 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 204 (E204G)

Ref Sequence

ENSEMBL: ENSMUSP00000098092 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000100523]

Predicted Effect

probably damaging
Transcript: ENSMUST00000100523
AA Change: E204G

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000098092
Gene: ENSMUSG00000075588
AA Change: E204G

Domain	Start	End	E-Value	Type
low complexity region	76	94	N/A	INTRINSIC
low complexity region	99	118	N/A	INTRINSIC
HOX	141	203	2.54e-28	SMART
low complexity region	204	213	N/A	INTRINSIC
low complexity region	317	330	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147410

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182030

Meta Mutation Damage Score

0.0936

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

100% (55/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Antp homeobox family and encodes a nuclear protein with a homeobox DNA-binding domain. It is included in a cluster of homeobox B genes located on chromosome 17. The encoded protein functions as a sequence-specific transcription factor that is involved in development. Increased expression of this gene is associated with pancreatic cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a reporter allele die neonatally with altered segmental identity and abnormal migration of motor neurons in the hindbrain. Mice homozygous for null alleles can exhibit partial postnatal lethality, narrow face, runting, absent facial motor nuclei, and facial nerve/muscle defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017N19Rik	T	C	10: 100,615,296		probably benign	Het
4932414N04Rik	T	C	2: 68,664,403		probably null	Het
Akr1c18	C	T	13: 4,135,285	V283I	probably benign	Het
Atp2b2	T	A	6: 113,760,831	M861L	possibly damaging	Het
Cdh23	T	C	10: 60,657,326	Y3C	probably benign	Het
Clspn	A	G	4: 126,576,379	E814G	probably damaging	Het
Csgalnact1	T	C	8: 68,461,262	Q97R	probably benign	Het
Dera	A	G	6: 137,837,120	Y100C	probably damaging	Het
Ect2	A	T	3: 27,130,120	D517E	probably benign	Het
Epha4	A	T	1: 77,399,716	Y509N	probably damaging	Het
Fat2	T	C	11: 55,296,382	T1213A	probably benign	Het
Fkbp8	T	A	8: 70,532,661	L275Q	probably damaging	Het
Gabrb2	A	G	11: 42,626,881	Y510C	probably damaging	Het
Gda	T	C	19: 21,472,445	T16A	probably benign	Het
Ggcx	G	A	6: 72,426,558	G363R	probably benign	Het
Gm527	T	G	12: 64,923,502		probably benign	Het
Hsd17b11	G	A	5: 103,992,937		probably benign	Het
Kat14	T	C	2: 144,407,329		probably benign	Het
Kif16b	C	T	2: 142,707,359	V1079I	probably benign	Het
Klhl29	T	A	12: 5,140,660	S112C	probably damaging	Het
Lpcat2	G	T	8: 92,864,903	M58I	probably benign	Het
Lrrc8d	G	T	5: 105,814,276	V851F	probably benign	Het
Ltbp3	T	C	19: 5,756,001	V929A	probably damaging	Het
Map3k20	T	G	2: 72,438,300	I550M	probably damaging	Het
Map3k9	T	C	12: 81,722,521	M941V	probably benign	Het
Myom2	A	T	8: 15,084,556	Y453F	probably benign	Het
Ncapd2	T	C	6: 125,186,784	K78E	probably damaging	Het
Ncor2	G	T	5: 125,032,256	D1496E	possibly damaging	Het
Ndnf	T	C	6: 65,703,141	Y135H	possibly damaging	Het
Ndst1	T	C	18: 60,697,139	N633S	probably benign	Het
Nmur2	G	C	11: 56,040,225	P220R	probably damaging	Het
Nsd1	G	C	13: 55,268,454	E1438Q	probably benign	Het
Olfr1043	G	T	2: 86,162,618	C110*	probably null	Het
Olfr1128	T	C	2: 87,545,065	T160A	probably damaging	Het
Olfr1413	T	A	1: 92,573,789	M206K	possibly damaging	Het
Olfr229	A	T	9: 39,910,725	R307S	probably benign	Het
Pom121l2	T	G	13: 21,982,128	S190A	probably damaging	Het
Prpmp5	G	A	6: 132,312,694	P56S	unknown	Het
Rtn4ip1	T	A	10: 43,909,897		probably null	Het
Scarb1	A	C	5: 125,287,411	C85G	probably damaging	Het
Sh2d4b	A	G	14: 40,872,546	I159T	probably damaging	Het
Sntg1	C	T	1: 8,782,901		probably benign	Het
Sos1	G	A	17: 80,424,181	T630I	probably damaging	Het
Spata7	T	A	12: 98,669,473	D517E	probably damaging	Het
Tcaf1	T	C	6: 42,679,059	T328A	probably benign	Het
Ticrr	T	C	7: 79,682,069	L776S	probably damaging	Het
Trpc2	T	A	7: 102,093,574	M597K	probably damaging	Het
Ttc37	T	G	13: 76,130,219	L551V	probably damaging	Het
Tubb3	C	A	8: 123,421,264	T312N	probably damaging	Het
Ubr4	G	A	4: 139,393,094	V277M	probably damaging	Het
Uhrf2	G	A	19: 30,079,861	R473Q	probably damaging	Het
Vmn2r43	T	A	7: 8,255,320	H298L	probably benign	Het

Other mutations in Hoxb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02992:Hoxb2	APN	11	96353084	missense	probably damaging	1.00
R6950:Hoxb2	UTSW	11	96351901	missense	probably benign	0.34
R7103:Hoxb2	UTSW	11	96353621	missense	possibly damaging	0.85
R7673:Hoxb2	UTSW	11	96353457	missense	possibly damaging	0.83
Z1177:Hoxb2	UTSW	11	96351989	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- TGATAACATAGGGGTGCTTCC -3'
(R):5'- AGAAAAGGCGAATCCTGCCG -3'

Sequencing Primer
(F):5'- ATTGCCAGAATGCGGCG -3'
(R):5'- ACACTCTCCAGGGTGGTG -3'

Posted On

2015-04-17