Incidental Mutation 'R3951:Sos1'
ID307966
Institutional Source Beutler Lab
Gene Symbol Sos1
Ensembl Gene ENSMUSG00000024241
Gene NameSOS Ras/Rac guanine nucleotide exchange factor 1
Synonyms4430401P03Rik
MMRRC Submission 040828-MU
Accession Numbers

Genbank: NM_009231.2; Ensembl: ENSMUST00000068714

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3951 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location80393752-80480453 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 80424181 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 630 (T630I)
Ref Sequence ENSEMBL: ENSMUSP00000067786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068714]
PDB Structure CRK SH3 DOMAIN COMPLEXED WITH PEPTOID INHIBITOR [X-RAY DIFFRACTION]
SOLUTION NMR STRUCTURE OF THE GRB2 N-TERMINAL SH3 DOMAIN COMPLEXED WITH A TEN-RESIDUE PEPTIDE DERIVED FROM SOS DIRECT REFINEMENT AGAINST NOES, J-COUPLINGS, AND 1H AND 13C CHEMICAL SHIFTS, MINIMIZED AVERAGE STRUCTURE [SOLUTION NMR]
PLECKSTRIN HOMOLOGY DOMAIN OF SON OF SEVENLESS 1 (SOS1) WITH GLYCINE-SERINE ADDED TO THE N-TERMINUS, NMR, 20 STRUCTURES [SOLUTION NMR]
SOLUTION NMR STRUCTURE OF THE GRB2 N-TERMINAL SH3 DOMAIN COMPLEXED WITH A TEN-RESIDUE PEPTIDE DERIVED FROM SOS DIRECT REFINEMENT AGAINST NOES, J-COUPLINGS, AND 1H AND 13C CHEMICAL SHIFTS, 15 STRUCTURES [SOLUTION NMR]
SOLUTION NMR STRUCTURE OF THE GRB2 N-TERMINAL SH3 DOMAIN COMPLEXED WITH A TEN-RESIDUE PEPTIDE DERIVED FROM SOS DIRECT REFINEMENT AGAINST NOES, J-COUPLINGS, AND 1H AND 13C CHEMICAL SHIFTS, MINIMIZED AVERAGE STRUCTURE [SOLUTION NMR]
SOLUTION NMR STRUCTURE OF THE GRB2 N-TERMINAL SH3 DOMAIN COMPLEXED WITH A TEN-RESIDUE PEPTIDE DERIVED FROM SOS DIRECT REFINEMENT AGAINST NOES, J-COUPLINGS, AND 1H AND 13C CHEMICAL SHIFTS, 15 STRUCTURES [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000068714
AA Change: T630I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000067786
Gene: ENSMUSG00000024241
AA Change: T630I

DomainStartEndE-ValueType
Pfam:Histone 40 169 6.8e-16 PFAM
RhoGEF 204 389 8.5e-35 SMART
PH 444 548 2.44e-17 SMART
RasGEFN 596 741 2.18e-56 SMART
RasGEF 776 1020 4.44e-102 SMART
low complexity region 1079 1093 N/A INTRINSIC
low complexity region 1116 1127 N/A INTRINSIC
low complexity region 1132 1154 N/A INTRINSIC
Blast:RasGEF 1155 1306 1e-51 BLAST
Meta Mutation Damage Score 0.7022 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a guanine nucleotide exchange factor for RAS proteins, membrane proteins that bind guanine nucleotides and participate in signal transduction pathways. GTP binding activates and GTP hydrolysis inactivates RAS proteins. The product of this gene may regulate RAS proteins by facilitating the exchange of GTP for GDP. Mutations in this gene are associated with gingival fibromatosis 1 and Noonan syndrome type 4. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutant embryos exhibit placental and cardiovascular defects resulting in death around mid-gestation. When heterozygous, these mutations enhance the eye defects of homozygous mutants of the epidermal growth factor receptor gene. [provided by MGI curators]
Allele List at MGI

All alleles(25) : Targeted, knock-out(2) Targeted, other(2) Gene trapped(21)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik T C 10: 100,615,296 probably benign Het
4932414N04Rik T C 2: 68,664,403 probably null Het
Akr1c18 C T 13: 4,135,285 V283I probably benign Het
Atp2b2 T A 6: 113,760,831 M861L possibly damaging Het
Cdh23 T C 10: 60,657,326 Y3C probably benign Het
Clspn A G 4: 126,576,379 E814G probably damaging Het
Csgalnact1 T C 8: 68,461,262 Q97R probably benign Het
Dera A G 6: 137,837,120 Y100C probably damaging Het
Ect2 A T 3: 27,130,120 D517E probably benign Het
Epha4 A T 1: 77,399,716 Y509N probably damaging Het
Fat2 T C 11: 55,296,382 T1213A probably benign Het
Fkbp8 T A 8: 70,532,661 L275Q probably damaging Het
Gabrb2 A G 11: 42,626,881 Y510C probably damaging Het
Gda T C 19: 21,472,445 T16A probably benign Het
Ggcx G A 6: 72,426,558 G363R probably benign Het
Gm527 T G 12: 64,923,502 probably benign Het
Hoxb2 A G 11: 96,353,175 E204G probably damaging Het
Hsd17b11 G A 5: 103,992,937 probably benign Het
Kat14 T C 2: 144,407,329 probably benign Het
Kif16b C T 2: 142,707,359 V1079I probably benign Het
Klhl29 T A 12: 5,140,660 S112C probably damaging Het
Lpcat2 G T 8: 92,864,903 M58I probably benign Het
Lrrc8d G T 5: 105,814,276 V851F probably benign Het
Ltbp3 T C 19: 5,756,001 V929A probably damaging Het
Map3k20 T G 2: 72,438,300 I550M probably damaging Het
Map3k9 T C 12: 81,722,521 M941V probably benign Het
Myom2 A T 8: 15,084,556 Y453F probably benign Het
Ncapd2 T C 6: 125,186,784 K78E probably damaging Het
Ncor2 G T 5: 125,032,256 D1496E possibly damaging Het
Ndnf T C 6: 65,703,141 Y135H possibly damaging Het
Ndst1 T C 18: 60,697,139 N633S probably benign Het
Nmur2 G C 11: 56,040,225 P220R probably damaging Het
Nsd1 G C 13: 55,268,454 E1438Q probably benign Het
Olfr1043 G T 2: 86,162,618 C110* probably null Het
Olfr1128 T C 2: 87,545,065 T160A probably damaging Het
Olfr1413 T A 1: 92,573,789 M206K possibly damaging Het
Olfr229 A T 9: 39,910,725 R307S probably benign Het
Pom121l2 T G 13: 21,982,128 S190A probably damaging Het
Prpmp5 G A 6: 132,312,694 P56S unknown Het
Rtn4ip1 T A 10: 43,909,897 probably null Het
Scarb1 A C 5: 125,287,411 C85G probably damaging Het
Sh2d4b A G 14: 40,872,546 I159T probably damaging Het
Sntg1 C T 1: 8,782,901 probably benign Het
Spata7 T A 12: 98,669,473 D517E probably damaging Het
Tcaf1 T C 6: 42,679,059 T328A probably benign Het
Ticrr T C 7: 79,682,069 L776S probably damaging Het
Trpc2 T A 7: 102,093,574 M597K probably damaging Het
Ttc37 T G 13: 76,130,219 L551V probably damaging Het
Tubb3 C A 8: 123,421,264 T312N probably damaging Het
Ubr4 G A 4: 139,393,094 V277M probably damaging Het
Uhrf2 G A 19: 30,079,861 R473Q probably damaging Het
Vmn2r43 T A 7: 8,255,320 H298L probably benign Het
Other mutations in Sos1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00805:Sos1 APN 17 80398524 missense possibly damaging 0.94
IGL00915:Sos1 APN 17 80433938 missense probably benign 0.00
IGL00929:Sos1 APN 17 80408596 missense probably damaging 1.00
IGL01073:Sos1 APN 17 80422747 missense probably damaging 1.00
IGL01116:Sos1 APN 17 80445500 missense probably damaging 1.00
IGL01533:Sos1 APN 17 80415082 missense probably damaging 0.97
IGL01546:Sos1 APN 17 80408611 missense probably damaging 1.00
IGL01583:Sos1 APN 17 80433900 missense probably benign 0.11
IGL01628:Sos1 APN 17 80422677 splice site probably benign
IGL01837:Sos1 APN 17 80422728 missense probably damaging 1.00
IGL02170:Sos1 APN 17 80398290 missense probably damaging 0.99
IGL02426:Sos1 APN 17 80434943 missense possibly damaging 0.82
IGL02992:Sos1 APN 17 80419016 missense probably benign 0.01
IGL03037:Sos1 APN 17 80420329 missense probably damaging 0.98
1mM(1):Sos1 UTSW 17 80455057 missense possibly damaging 0.46
BB007:Sos1 UTSW 17 80406838 missense probably benign 0.00
BB017:Sos1 UTSW 17 80406838 missense probably benign 0.00
PIT4354001:Sos1 UTSW 17 80449356 missense possibly damaging 0.52
R0056:Sos1 UTSW 17 80413621 missense probably damaging 1.00
R0348:Sos1 UTSW 17 80408311 missense probably benign
R0373:Sos1 UTSW 17 80453763 missense probably damaging 1.00
R0477:Sos1 UTSW 17 80434934 missense possibly damaging 0.92
R0621:Sos1 UTSW 17 80451979 critical splice donor site probably null
R0839:Sos1 UTSW 17 80433730 missense probably damaging 1.00
R1174:Sos1 UTSW 17 80445608 nonsense probably null
R1490:Sos1 UTSW 17 80413675 missense probably benign 0.11
R1566:Sos1 UTSW 17 80453916 missense probably damaging 0.99
R1635:Sos1 UTSW 17 80422679 splice site probably null
R3412:Sos1 UTSW 17 80406717 missense probably benign
R3770:Sos1 UTSW 17 80398308 missense probably damaging 0.97
R3964:Sos1 UTSW 17 80455179 missense probably damaging 1.00
R3966:Sos1 UTSW 17 80455179 missense probably damaging 1.00
R4086:Sos1 UTSW 17 80449352 missense probably benign 0.06
R4087:Sos1 UTSW 17 80449352 missense probably benign 0.06
R4089:Sos1 UTSW 17 80449352 missense probably benign 0.06
R4194:Sos1 UTSW 17 80398584 missense probably benign 0.02
R4468:Sos1 UTSW 17 80453811 missense probably damaging 1.00
R4469:Sos1 UTSW 17 80453811 missense probably damaging 1.00
R4597:Sos1 UTSW 17 80433826 missense probably benign 0.05
R4773:Sos1 UTSW 17 80398231 missense probably damaging 0.99
R4923:Sos1 UTSW 17 80434952 missense probably benign 0.10
R5120:Sos1 UTSW 17 80408248 missense probably damaging 0.98
R5478:Sos1 UTSW 17 80433847 missense probably damaging 1.00
R5566:Sos1 UTSW 17 80453890 missense possibly damaging 0.91
R5984:Sos1 UTSW 17 80452132 missense possibly damaging 0.68
R6053:Sos1 UTSW 17 80415034 missense possibly damaging 0.94
R6153:Sos1 UTSW 17 80449335 missense probably benign 0.01
R6567:Sos1 UTSW 17 80433503 missense probably damaging 1.00
R7392:Sos1 UTSW 17 80424200 missense probably damaging 1.00
R7623:Sos1 UTSW 17 80479894 missense probably benign 0.28
R7763:Sos1 UTSW 17 80413713 missense probably benign
R7930:Sos1 UTSW 17 80406838 missense probably benign 0.00
R8132:Sos1 UTSW 17 80408602 missense probably damaging 1.00
R8236:Sos1 UTSW 17 80408283 missense probably benign 0.41
R8322:Sos1 UTSW 17 80408299 missense probably damaging 0.96
R8348:Sos1 UTSW 17 80434119 missense probably benign 0.00
R8448:Sos1 UTSW 17 80434119 missense probably benign 0.00
R8554:Sos1 UTSW 17 80398413 missense probably damaging 0.99
X0020:Sos1 UTSW 17 80449277 missense probably damaging 1.00
Z1177:Sos1 UTSW 17 80453918 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGAGACCCTGAGAAGTTGGG -3'
(R):5'- GTCCATTATATAATCCAAAGCCGTC -3'

Sequencing Primer
(F):5'- ACCCTGAGAAGTTGGGAGTTTTAAG -3'
(R):5'- CCGTCTCTCTGGTAAAACATTTAGGG -3'
Posted On2015-04-17