Incidental Mutation 'R0377:Sult1b1'
ID30797
Institutional Source Beutler Lab
Gene Symbol Sult1b1
Ensembl Gene ENSMUSG00000029269
Gene Namesulfotransferase family 1B, member 1
SynonymsDopa/tyrosine sulfotransferase
MMRRC Submission 038583-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0377 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location87513339-87538195 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 87517376 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 233 (M233K)
Ref Sequence ENSEMBL: ENSMUSP00000112844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031199] [ENSMUST00000117455] [ENSMUST00000120150]
Predicted Effect probably damaging
Transcript: ENSMUST00000031199
AA Change: M233K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031199
Gene: ENSMUSG00000029269
AA Change: M233K

DomainStartEndE-ValueType
Pfam:Sulfotransfer_1 38 289 7.5e-93 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117455
AA Change: M233K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112679
Gene: ENSMUSG00000029269
AA Change: M233K

DomainStartEndE-ValueType
Pfam:Sulfotransfer_1 38 289 7.5e-93 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120150
AA Change: M233K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112844
Gene: ENSMUSG00000029269
AA Change: M233K

DomainStartEndE-ValueType
Pfam:Sulfotransfer_1 38 289 7.5e-93 PFAM
Meta Mutation Damage Score 0.9222 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.8%
Validation Efficiency 97% (67/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sulfotransferase enzymes catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs, and xenobiotic compounds. These cytosolic enzymes are different in their tissue distributions and substrate specificities. The gene structure (number and length of exons) is similar among family members. However, the total genomic length of this gene is greater than that of other SULT1 genes. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 C A 11: 94,375,096 V107F possibly damaging Het
Acad11 T A 9: 104,081,692 probably benign Het
Ache G A 5: 137,290,928 E299K possibly damaging Het
Adam5 T C 8: 24,747,541 T618A probably benign Het
Amigo2 T A 15: 97,246,380 T54S possibly damaging Het
Anapc1 A G 2: 128,641,340 probably null Het
Armc4 G A 18: 7,127,415 R933C probably benign Het
Btaf1 A G 19: 36,989,002 K1057E probably benign Het
Cep55 T A 19: 38,071,889 L396* probably null Het
Cic C A 7: 25,285,799 H1157N probably damaging Het
Cntnap5a A T 1: 116,292,529 T690S probably benign Het
D5Ertd579e A T 5: 36,604,567 C1319S probably benign Het
Dnah6 A G 6: 73,121,992 S2027P possibly damaging Het
Dntt G A 19: 41,047,627 W369* probably null Het
Esp18 T A 17: 39,409,944 W27R probably benign Het
Fam227b A T 2: 126,125,000 probably benign Het
Fbxo31 G A 8: 121,559,102 probably benign Het
Gm13547 G A 2: 29,761,791 probably null Het
Gnl2 T A 4: 125,046,382 probably benign Het
Gpx2 G A 12: 76,795,156 Q74* probably null Het
Gucy2c A G 6: 136,750,917 probably null Het
Hoxa5 A T 6: 52,202,646 W250R probably damaging Het
Izumo4 G A 10: 80,702,840 R42H probably damaging Het
Kcnj12 G A 11: 61,069,396 M71I probably benign Het
Kmt2b A T 7: 30,574,193 L2333Q probably damaging Het
Mak T C 13: 41,049,348 E177G probably damaging Het
Map3k7 T A 4: 31,985,731 I218N probably damaging Het
Mark3 T C 12: 111,629,029 L393P probably damaging Het
Msh4 A G 3: 153,896,890 S234P probably benign Het
Mug1 A G 6: 121,857,361 D367G probably benign Het
Mypn A G 10: 63,127,622 probably benign Het
Ncapg T C 5: 45,693,817 V784A probably benign Het
Nutf2 T A 8: 105,878,872 V113D probably damaging Het
Olfr1080 A T 2: 86,553,583 D180E probably damaging Het
Opn3 T C 1: 175,663,694 M258V probably damaging Het
Osbpl7 A G 11: 97,055,934 D211G probably damaging Het
Pcnx C T 12: 81,974,579 probably benign Het
Plekhd1 G A 12: 80,706,436 probably benign Het
Pnpla6 A G 8: 3,541,501 E1165G probably damaging Het
Prkab2 T A 3: 97,662,317 D66E probably benign Het
Prpsap2 A G 11: 61,741,000 I177T possibly damaging Het
Ptpn23 A T 9: 110,388,132 S885R possibly damaging Het
Rab26 A T 17: 24,530,045 probably benign Het
Rab5a G A 17: 53,500,462 M175I probably benign Het
Rassf9 T A 10: 102,545,649 D297E probably benign Het
Rimbp2 C T 5: 128,803,861 R161Q probably damaging Het
Rtp1 A G 16: 23,431,284 Y133C probably damaging Het
Sdr16c5 G A 4: 4,005,546 L263F probably benign Het
Sec14l1 T G 11: 117,149,140 probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spaca1 T C 4: 34,044,267 probably null Het
Stk36 C T 1: 74,612,730 P394L probably benign Het
Stk4 T C 2: 164,096,800 I196T probably damaging Het
Tmem8b C T 4: 43,674,005 T212M probably damaging Het
Tmprss11g A T 5: 86,490,751 F293I probably damaging Het
Tnfsf11 T G 14: 78,299,912 T104P probably benign Het
Trmt2a G A 16: 18,249,703 R80Q possibly damaging Het
Trps1 C A 15: 50,831,778 E324* probably null Het
U2surp C T 9: 95,484,443 V470I probably benign Het
Wdr18 G A 10: 79,967,502 R400H probably benign Het
Wdr78 A G 4: 103,048,259 V775A probably damaging Het
Zfp119b T A 17: 55,938,671 H505L probably damaging Het
Zfp619 T A 7: 39,536,797 C750* probably null Het
Zfr T C 15: 12,160,591 I750T probably benign Het
Other mutations in Sult1b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01296:Sult1b1 APN 5 87514956 missense probably benign 0.28
IGL02214:Sult1b1 APN 5 87535090 utr 5 prime probably benign
R0835:Sult1b1 UTSW 5 87517452 missense probably benign 0.00
R1850:Sult1b1 UTSW 5 87520841 missense probably damaging 1.00
R2059:Sult1b1 UTSW 5 87535033 missense probably damaging 0.98
R4792:Sult1b1 UTSW 5 87515047 missense probably damaging 1.00
R4904:Sult1b1 UTSW 5 87535053 missense probably benign 0.39
R5127:Sult1b1 UTSW 5 87521548 missense probably damaging 1.00
R5282:Sult1b1 UTSW 5 87530651 missense probably benign 0.01
R5981:Sult1b1 UTSW 5 87534957 missense probably damaging 1.00
R6270:Sult1b1 UTSW 5 87517554 intron probably null
R6442:Sult1b1 UTSW 5 87535053 missense probably benign 0.39
R7681:Sult1b1 UTSW 5 87530636 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCTAGGCAAACTGCCAGTGAGG -3'
(R):5'- CCTGAGTGCAGAAGCTCATGGAATG -3'

Sequencing Primer
(F):5'- TCAACTGCATTTAGAGTAGCAAAGG -3'
(R):5'- CAGAAGCTCATGGAATGTTACATGTC -3'
Posted On2013-04-24