Incidental Mutation 'R3952:Abl1'
ID307972
Institutional Source Beutler Lab
Gene Symbol Abl1
Ensembl Gene ENSMUSG00000026842
Gene Namec-abl oncogene 1, non-receptor tyrosine kinase
Synonymsc-Abl, E430008G22Rik
MMRRC Submission 040829-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.941) question?
Stock #R3952 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location31688376-31804227 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 31784537 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 213 (T213S)
Ref Sequence ENSEMBL: ENSMUSP00000075167 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028190] [ENSMUST00000075759] [ENSMUST00000142554]
Predicted Effect probably damaging
Transcript: ENSMUST00000028190
AA Change: T194S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000028190
Gene: ENSMUSG00000026842
AA Change: T194S

DomainStartEndE-ValueType
low complexity region 5 23 N/A INTRINSIC
SH3 64 120 6.95e-16 SMART
SH2 125 208 6.52e-32 SMART
TyrKc 242 493 4.48e-149 SMART
low complexity region 698 703 N/A INTRINSIC
low complexity region 802 810 N/A INTRINSIC
low complexity region 883 907 N/A INTRINSIC
low complexity region 949 960 N/A INTRINSIC
low complexity region 964 983 N/A INTRINSIC
FABD 997 1123 1.36e-63 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000075759
AA Change: T213S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000075167
Gene: ENSMUSG00000026842
AA Change: T213S

DomainStartEndE-ValueType
SH3 83 139 6.95e-16 SMART
SH2 144 227 6.52e-32 SMART
TyrKc 261 512 4.48e-149 SMART
low complexity region 717 722 N/A INTRINSIC
low complexity region 821 829 N/A INTRINSIC
low complexity region 902 926 N/A INTRINSIC
low complexity region 968 979 N/A INTRINSIC
low complexity region 983 1002 N/A INTRINSIC
FABD 1016 1142 1.36e-63 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142554
SMART Domains Protein: ENSMUSP00000142123
Gene: ENSMUSG00000026842

DomainStartEndE-ValueType
PDB:1OPL|B 1 47 2e-27 PDB
Meta Mutation Damage Score 0.2897 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a protooncogene that encodes a protein tyrosine kinase involved in a variety of cellular processes, including cell division, adhesion, differentiation, and response to stress. The activity of the protein is negatively regulated by its SH3 domain, whereby deletion of the region encoding this domain results in an oncogene. The ubiquitously expressed protein has DNA-binding activity that is regulated by CDC2-mediated phosphorylation, suggesting a cell cycle function. This gene has been found fused to a variety of translocation partner genes in various leukemias, most notably the t(9;22) translocation that results in a fusion with the 5' end of the breakpoint cluster region gene (BCR; MIM:151410). Alternative splicing of this gene results in two transcript variants, which contain alternative first exons that are spliced to the remaining common exons. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene have increased perinatal and postnatal mortality and may display foreshortened crania, abnormal development of spleen, head, heart and eye, reduced B and T cell populations, and osteoporosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik T C 10: 100,615,296 probably benign Het
4833423E24Rik T C 2: 85,500,204 probably benign Het
4932414N04Rik T C 2: 68,664,403 probably null Het
Abi3bp C T 16: 56,604,038 T450I possibly damaging Het
Apc2 C T 10: 80,314,484 R1762W probably damaging Het
Arl2 G T 19: 6,134,677 T182N probably benign Het
Brd8 C G 18: 34,614,444 probably benign Het
Cdh23 T C 10: 60,657,326 Y3C probably benign Het
Clca3a2 A G 3: 144,803,061 Y666H probably damaging Het
Cmya5 A G 13: 93,089,199 V3127A possibly damaging Het
Copg1 G A 6: 87,905,216 A598T probably benign Het
Dera A G 6: 137,837,120 Y100C probably damaging Het
Epha1 C A 6: 42,364,285 L535F probably damaging Het
Epha4 A T 1: 77,399,716 Y509N probably damaging Het
Ggcx G A 6: 72,426,558 G363R probably benign Het
Gm13101 C T 4: 143,965,786 W215* probably null Het
Hjurp G C 1: 88,277,215 probably benign Het
Kpna1 A T 16: 36,002,882 T35S probably benign Het
Map3k20 T G 2: 72,438,300 I550M probably damaging Het
Mgat4a A G 1: 37,450,414 probably benign Het
Mrpl48 T A 7: 100,559,923 probably benign Het
Ncapd2 T C 6: 125,186,784 K78E probably damaging Het
Ndst1 T C 18: 60,697,139 N633S probably benign Het
Olfr1128 T C 2: 87,545,065 T160A probably damaging Het
Olfr519 C A 7: 108,893,982 V142L probably benign Het
Olfr816 A G 10: 129,911,636 I214T probably benign Het
Pacs2 T C 12: 113,061,113 S408P probably damaging Het
Pcx C T 19: 4,617,967 H506Y probably benign Het
Pla2g6 G T 15: 79,313,096 P93T probably damaging Het
Prpmp5 G A 6: 132,312,694 P56S unknown Het
Rcor1 A G 12: 111,039,735 probably benign Het
Rtn4ip1 T A 10: 43,909,897 probably null Het
Sytl2 T A 7: 90,381,492 probably benign Het
Tia1 T C 6: 86,416,337 F53S probably damaging Het
Ticrr T C 7: 79,682,069 L776S probably damaging Het
Tmod1 A G 4: 46,078,315 N41S probably damaging Het
Ttn T C 2: 76,752,795 I22585V possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ugt1a10 C A 1: 88,216,140 H361N probably damaging Het
Vmn1r118 G T 7: 20,912,008 Q114K probably damaging Het
Vps39 C T 2: 120,350,175 R43Q probably benign Het
Vwa5b2 T C 16: 20,598,361 *603Q probably null Het
Zeb1 G A 18: 5,772,716 A1002T probably benign Het
Zxdc A G 6: 90,370,467 probably null Het
Other mutations in Abl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Abl1 APN 2 31790812 missense probably damaging 1.00
IGL01453:Abl1 APN 2 31778977 missense probably damaging 0.99
IGL02079:Abl1 APN 2 31689948 splice site probably benign
IGL02179:Abl1 APN 2 31792249 missense probably damaging 1.00
IGL02424:Abl1 APN 2 31801132 missense probably benign
IGL02824:Abl1 APN 2 31800819 missense probably damaging 1.00
Hourglass UTSW 2 31794574 missense probably damaging 1.00
Sands UTSW 2 31779010 missense probably damaging 1.00
R0733:Abl1 UTSW 2 31778945 missense probably damaging 1.00
R1222:Abl1 UTSW 2 31800994 missense probably benign
R1428:Abl1 UTSW 2 31801810 missense probably damaging 0.99
R1582:Abl1 UTSW 2 31800359 missense probably damaging 1.00
R1596:Abl1 UTSW 2 31790338 missense probably damaging 0.99
R1824:Abl1 UTSW 2 31800644 missense probably benign 0.01
R2240:Abl1 UTSW 2 31800505 missense probably benign 0.17
R2251:Abl1 UTSW 2 31779119 missense probably damaging 1.00
R2405:Abl1 UTSW 2 31800974 missense possibly damaging 0.50
R2893:Abl1 UTSW 2 31797612 missense probably benign 0.22
R4119:Abl1 UTSW 2 31801727 missense probably damaging 1.00
R4210:Abl1 UTSW 2 31801696 missense probably damaging 0.98
R4809:Abl1 UTSW 2 31800242 missense probably damaging 1.00
R4854:Abl1 UTSW 2 31779010 missense probably damaging 1.00
R5345:Abl1 UTSW 2 31797047 missense probably damaging 0.97
R5518:Abl1 UTSW 2 31790742 missense probably damaging 1.00
R5551:Abl1 UTSW 2 31801670 missense probably benign 0.03
R5568:Abl1 UTSW 2 31779074 missense probably damaging 1.00
R5627:Abl1 UTSW 2 31800583 missense probably benign 0.00
R6435:Abl1 UTSW 2 31801549 missense possibly damaging 0.93
R6492:Abl1 UTSW 2 31801655 missense probably benign 0.38
R6738:Abl1 UTSW 2 31794574 missense probably damaging 1.00
R7310:Abl1 UTSW 2 31800592 missense possibly damaging 0.93
R7398:Abl1 UTSW 2 31790799 missense probably damaging 1.00
R7639:Abl1 UTSW 2 31779161 missense probably damaging 1.00
R7674:Abl1 UTSW 2 31689829 missense possibly damaging 0.91
R7781:Abl1 UTSW 2 31790697 missense probably damaging 1.00
R7802:Abl1 UTSW 2 31760426 missense probably benign
Z1176:Abl1 UTSW 2 31689827 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGTTTAGCACTATCTATGCCC -3'
(R):5'- GTGAGGCTGTACTTCTTCCAAAC -3'

Sequencing Primer
(F):5'- TAGCACTATCTATGCCCTGGGG -3'
(R):5'- GTACACCTCCCCGTACTGG -3'
Posted On2015-04-17