Incidental Mutation 'R3952:Clca3a2'
ID 307983
Institutional Source Beutler Lab
Gene Symbol Clca3a2
Ensembl Gene ENSMUSG00000028262
Gene Name chloride channel accessory 3A2
Synonyms Clca2
MMRRC Submission 040829-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.089) question?
Stock # R3952 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 144502320-144525255 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 144508822 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 666 (Y666H)
Ref Sequence ENSEMBL: ENSMUSP00000029929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029929] [ENSMUST00000199029]
AlphaFold Q9EQR4
Predicted Effect probably damaging
Transcript: ENSMUST00000029929
AA Change: Y666H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029929
Gene: ENSMUSG00000028262
AA Change: Y666H

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 306 478 1.5e-21 SMART
FN3 758 857 5.49e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197013
Predicted Effect possibly damaging
Transcript: ENSMUST00000199029
AA Change: Y57H

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000143543
Gene: ENSMUSG00000028262
AA Change: Y57H

DomainStartEndE-ValueType
Pfam:CLCA 1 188 6.5e-77 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (46/47)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik T C 10: 100,451,158 (GRCm39) probably benign Het
4932414N04Rik T C 2: 68,494,747 (GRCm39) probably null Het
Abi3bp C T 16: 56,424,401 (GRCm39) T450I possibly damaging Het
Abl1 A T 2: 31,674,549 (GRCm39) T213S probably damaging Het
Apc2 C T 10: 80,150,318 (GRCm39) R1762W probably damaging Het
Arl2 G T 19: 6,184,707 (GRCm39) T182N probably benign Het
Brd8 C G 18: 34,747,497 (GRCm39) probably benign Het
Cdh23 T C 10: 60,493,105 (GRCm39) Y3C probably benign Het
Cmya5 A G 13: 93,225,707 (GRCm39) V3127A possibly damaging Het
Copg1 G A 6: 87,882,198 (GRCm39) A598T probably benign Het
Dera A G 6: 137,814,118 (GRCm39) Y100C probably damaging Het
Epha1 C A 6: 42,341,219 (GRCm39) L535F probably damaging Het
Epha4 A T 1: 77,376,353 (GRCm39) Y509N probably damaging Het
Fads2b T C 2: 85,330,548 (GRCm39) probably benign Het
Ggcx G A 6: 72,403,541 (GRCm39) G363R probably benign Het
Hjurp G C 1: 88,204,937 (GRCm39) probably benign Het
Kpna1 A T 16: 35,823,252 (GRCm39) T35S probably benign Het
Map3k20 T G 2: 72,268,644 (GRCm39) I550M probably damaging Het
Mgat4a A G 1: 37,489,495 (GRCm39) probably benign Het
Mrpl48 T A 7: 100,209,130 (GRCm39) probably benign Het
Ncapd2 T C 6: 125,163,747 (GRCm39) K78E probably damaging Het
Ndst1 T C 18: 60,830,211 (GRCm39) N633S probably benign Het
Or10a3n C A 7: 108,493,189 (GRCm39) V142L probably benign Het
Or5w10 T C 2: 87,375,409 (GRCm39) T160A probably damaging Het
Or6c69 A G 10: 129,747,505 (GRCm39) I214T probably benign Het
Pacs2 T C 12: 113,024,733 (GRCm39) S408P probably damaging Het
Pcx C T 19: 4,667,995 (GRCm39) H506Y probably benign Het
Pla2g6 G T 15: 79,197,296 (GRCm39) P93T probably damaging Het
Pramel28 C T 4: 143,692,356 (GRCm39) W215* probably null Het
Prb1b G A 6: 132,289,657 (GRCm39) P56S unknown Het
Rcor1 A G 12: 111,006,169 (GRCm39) probably benign Het
Rtn4ip1 T A 10: 43,785,893 (GRCm39) probably null Het
Sytl2 T A 7: 90,030,700 (GRCm39) probably benign Het
Tia1 T C 6: 86,393,319 (GRCm39) F53S probably damaging Het
Ticrr T C 7: 79,331,817 (GRCm39) L776S probably damaging Het
Tmod1 A G 4: 46,078,315 (GRCm39) N41S probably damaging Het
Ttn T C 2: 76,583,139 (GRCm39) I22585V possibly damaging Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Ugt1a10 C A 1: 88,143,862 (GRCm39) H361N probably damaging Het
Vmn1r118 G T 7: 20,645,933 (GRCm39) Q114K probably damaging Het
Vps39 C T 2: 120,180,656 (GRCm39) R43Q probably benign Het
Vwa5b2 T C 16: 20,417,111 (GRCm39) *603Q probably null Het
Zeb1 G A 18: 5,772,716 (GRCm39) A1002T probably benign Het
Zxdc A G 6: 90,347,449 (GRCm39) probably null Het
Other mutations in Clca3a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Clca3a2 APN 3 144,804,574 (GRCm39) missense probably damaging 1.00
IGL01019:Clca3a2 APN 3 144,519,388 (GRCm39) nonsense probably null
IGL01337:Clca3a2 APN 3 144,800,939 (GRCm39) missense probably damaging 1.00
IGL01389:Clca3a2 APN 3 144,783,629 (GRCm39) critical splice donor site probably null
IGL01595:Clca3a2 APN 3 144,793,768 (GRCm39) missense probably damaging 1.00
IGL01663:Clca3a2 APN 3 144,522,916 (GRCm39) missense probably damaging 0.97
IGL01704:Clca3a2 APN 3 144,800,979 (GRCm39) missense probably benign 0.04
IGL01779:Clca3a2 APN 3 144,525,139 (GRCm39) missense possibly damaging 0.47
IGL02066:Clca3a2 APN 3 144,519,216 (GRCm39) missense probably benign
IGL02301:Clca3a2 APN 3 144,512,133 (GRCm39) missense probably damaging 0.98
IGL02416:Clca3a2 APN 3 144,790,777 (GRCm39) missense probably benign 0.02
IGL02455:Clca3a2 APN 3 144,787,172 (GRCm39) missense probably benign 0.00
IGL02481:Clca3a2 APN 3 144,790,701 (GRCm39) missense possibly damaging 0.92
IGL02526:Clca3a2 APN 3 144,793,779 (GRCm39) missense probably benign 0.02
IGL02619:Clca3a2 APN 3 144,512,083 (GRCm39) missense probably damaging 1.00
IGL02797:Clca3a2 APN 3 144,787,024 (GRCm39) missense probably benign 0.02
IGL02852:Clca3a2 APN 3 144,512,104 (GRCm39) missense probably damaging 0.98
IGL02901:Clca3a2 APN 3 144,522,529 (GRCm39) missense probably damaging 1.00
IGL03162:Clca3a2 APN 3 144,512,177 (GRCm39) missense probably damaging 1.00
IGL03253:Clca3a2 APN 3 144,777,324 (GRCm39) missense probably benign 0.41
IGL03256:Clca3a2 APN 3 144,792,153 (GRCm39) missense possibly damaging 0.75
IGL03294:Clca3a2 APN 3 144,803,530 (GRCm39) missense probably damaging 1.00
3370:Clca3a2 UTSW 3 144,783,738 (GRCm39) missense probably damaging 1.00
R0032:Clca3a2 UTSW 3 144,522,494 (GRCm39) missense probably benign 0.01
R0244:Clca3a2 UTSW 3 144,519,659 (GRCm39) missense possibly damaging 0.90
R0479:Clca3a2 UTSW 3 144,796,610 (GRCm39) missense probably damaging 1.00
R0542:Clca3a2 UTSW 3 144,781,571 (GRCm39) splice site probably benign
R0629:Clca3a2 UTSW 3 144,778,000 (GRCm39) missense probably benign
R1249:Clca3a2 UTSW 3 144,508,765 (GRCm39) missense possibly damaging 0.80
R1370:Clca3a2 UTSW 3 144,519,624 (GRCm39) splice site probably benign
R1488:Clca3a2 UTSW 3 144,789,925 (GRCm39) missense possibly damaging 0.49
R1523:Clca3a2 UTSW 3 144,777,405 (GRCm39) nonsense probably null
R1568:Clca3a2 UTSW 3 144,781,410 (GRCm39) nonsense probably null
R1586:Clca3a2 UTSW 3 144,516,477 (GRCm39) missense possibly damaging 0.94
R1650:Clca3a2 UTSW 3 144,797,973 (GRCm39) missense probably damaging 1.00
R1771:Clca3a2 UTSW 3 144,787,171 (GRCm39) missense probably benign 0.12
R1776:Clca3a2 UTSW 3 144,519,681 (GRCm39) missense probably damaging 1.00
R1797:Clca3a2 UTSW 3 144,503,398 (GRCm39) missense probably benign 0.01
R1869:Clca3a2 UTSW 3 144,512,164 (GRCm39) missense probably benign 0.44
R1871:Clca3a2 UTSW 3 144,503,398 (GRCm39) missense probably benign 0.01
R1919:Clca3a2 UTSW 3 144,516,457 (GRCm39) missense probably benign
R1923:Clca3a2 UTSW 3 144,511,491 (GRCm39) missense probably damaging 1.00
R2101:Clca3a2 UTSW 3 144,783,699 (GRCm39) missense probably damaging 0.99
R2200:Clca3a2 UTSW 3 144,519,685 (GRCm39) missense probably benign 0.10
R2242:Clca3a2 UTSW 3 144,796,551 (GRCm39) missense probably damaging 0.98
R2324:Clca3a2 UTSW 3 144,512,041 (GRCm39) critical splice donor site probably null
R2937:Clca3a2 UTSW 3 144,519,679 (GRCm39) missense probably benign 0.06
R3429:Clca3a2 UTSW 3 144,512,088 (GRCm39) missense probably benign 0.07
R3434:Clca3a2 UTSW 3 144,514,522 (GRCm39) unclassified probably benign
R3551:Clca3a2 UTSW 3 144,508,842 (GRCm39) missense probably damaging 1.00
R3751:Clca3a2 UTSW 3 144,777,216 (GRCm39) missense probably benign 0.04
R4120:Clca3a2 UTSW 3 144,516,613 (GRCm39) missense probably benign 0.25
R4383:Clca3a2 UTSW 3 144,512,081 (GRCm39) missense probably benign 0.02
R4496:Clca3a2 UTSW 3 144,797,926 (GRCm39) missense possibly damaging 0.94
R4518:Clca3a2 UTSW 3 144,514,466 (GRCm39) missense probably damaging 1.00
R4598:Clca3a2 UTSW 3 144,511,444 (GRCm39) missense probably damaging 1.00
R4801:Clca3a2 UTSW 3 144,513,112 (GRCm39) missense possibly damaging 0.95
R4802:Clca3a2 UTSW 3 144,513,112 (GRCm39) missense possibly damaging 0.95
R4816:Clca3a2 UTSW 3 144,516,613 (GRCm39) missense probably benign 0.25
R4934:Clca3a2 UTSW 3 144,523,692 (GRCm39) missense probably damaging 1.00
R4942:Clca3a2 UTSW 3 144,512,263 (GRCm39) missense probably damaging 1.00
R4962:Clca3a2 UTSW 3 144,783,640 (GRCm39) missense probably damaging 1.00
R5123:Clca3a2 UTSW 3 144,512,104 (GRCm39) missense probably damaging 1.00
R5156:Clca3a2 UTSW 3 144,511,599 (GRCm39) missense probably benign 0.26
R5275:Clca3a2 UTSW 3 144,519,340 (GRCm39) missense probably damaging 1.00
R5344:Clca3a2 UTSW 3 144,793,703 (GRCm39) missense probably damaging 1.00
R5372:Clca3a2 UTSW 3 144,503,286 (GRCm39) missense probably benign 0.00
R5424:Clca3a2 UTSW 3 144,789,942 (GRCm39) missense probably damaging 0.99
R5656:Clca3a2 UTSW 3 144,503,393 (GRCm39) missense probably benign 0.26
R5931:Clca3a2 UTSW 3 144,797,886 (GRCm39) missense possibly damaging 0.88
R6059:Clca3a2 UTSW 3 144,516,531 (GRCm39) missense probably damaging 1.00
R6155:Clca3a2 UTSW 3 144,525,118 (GRCm39) missense probably damaging 0.99
R6181:Clca3a2 UTSW 3 144,796,469 (GRCm39) nonsense probably null
R6254:Clca3a2 UTSW 3 144,507,895 (GRCm39) missense probably benign
R6336:Clca3a2 UTSW 3 144,512,239 (GRCm39) missense probably benign
R6470:Clca3a2 UTSW 3 144,510,024 (GRCm39) splice site probably null
R6593:Clca3a2 UTSW 3 144,514,338 (GRCm39) critical splice donor site probably null
R6598:Clca3a2 UTSW 3 144,792,246 (GRCm39) nonsense probably null
R6631:Clca3a2 UTSW 3 144,519,405 (GRCm39) missense probably benign
R6826:Clca3a2 UTSW 3 144,523,815 (GRCm39) missense possibly damaging 0.46
R6836:Clca3a2 UTSW 3 144,512,144 (GRCm39) missense probably damaging 0.97
R6896:Clca3a2 UTSW 3 144,514,462 (GRCm39) missense probably damaging 1.00
R7167:Clca3a2 UTSW 3 144,803,545 (GRCm39) missense probably benign 0.40
R7211:Clca3a2 UTSW 3 144,519,775 (GRCm39) missense probably benign 0.00
R7229:Clca3a2 UTSW 3 144,789,869 (GRCm39) missense probably damaging 1.00
R7256:Clca3a2 UTSW 3 144,796,608 (GRCm39) missense probably damaging 0.99
R7324:Clca3a2 UTSW 3 144,514,372 (GRCm39) missense probably damaging 0.99
R7365:Clca3a2 UTSW 3 144,804,545 (GRCm39) missense probably damaging 1.00
R7411:Clca3a2 UTSW 3 144,507,860 (GRCm39) missense probably damaging 1.00
R7486:Clca3a2 UTSW 3 144,503,362 (GRCm39) missense probably damaging 1.00
R7491:Clca3a2 UTSW 3 144,519,340 (GRCm39) missense probably damaging 1.00
R7521:Clca3a2 UTSW 3 144,507,674 (GRCm39) makesense probably null
R7813:Clca3a2 UTSW 3 144,790,726 (GRCm39) missense probably benign 0.26
R7889:Clca3a2 UTSW 3 144,516,574 (GRCm39) nonsense probably null
R7946:Clca3a2 UTSW 3 144,513,075 (GRCm39) critical splice donor site probably null
R7991:Clca3a2 UTSW 3 144,519,756 (GRCm39) missense probably benign 0.00
R8022:Clca3a2 UTSW 3 144,511,527 (GRCm39) missense probably damaging 1.00
R8077:Clca3a2 UTSW 3 144,777,288 (GRCm39) missense possibly damaging 0.56
R8169:Clca3a2 UTSW 3 144,783,653 (GRCm39) missense probably damaging 1.00
R8290:Clca3a2 UTSW 3 144,793,719 (GRCm39) missense possibly damaging 0.93
R8300:Clca3a2 UTSW 3 144,804,692 (GRCm39) missense probably benign 0.00
R8344:Clca3a2 UTSW 3 144,511,703 (GRCm39) critical splice acceptor site probably null
R8350:Clca3a2 UTSW 3 144,783,668 (GRCm39) missense probably benign 0.19
R8367:Clca3a2 UTSW 3 144,523,508 (GRCm39) splice site probably null
R8371:Clca3a2 UTSW 3 144,513,114 (GRCm39) nonsense probably null
R8814:Clca3a2 UTSW 3 144,503,525 (GRCm39) missense probably benign 0.18
R8854:Clca3a2 UTSW 3 144,783,852 (GRCm39) missense possibly damaging 0.94
R8876:Clca3a2 UTSW 3 144,777,360 (GRCm39) missense probably benign 0.00
R8887:Clca3a2 UTSW 3 144,790,810 (GRCm39) nonsense probably null
R9006:Clca3a2 UTSW 3 144,783,789 (GRCm39) missense probably damaging 0.99
R9031:Clca3a2 UTSW 3 144,511,475 (GRCm39) missense probably damaging 1.00
R9069:Clca3a2 UTSW 3 144,519,447 (GRCm39) splice site probably benign
R9093:Clca3a2 UTSW 3 144,781,481 (GRCm39) missense probably benign 0.20
R9190:Clca3a2 UTSW 3 144,796,599 (GRCm39) missense probably benign 0.00
R9201:Clca3a2 UTSW 3 144,519,684 (GRCm39) missense probably benign 0.00
R9209:Clca3a2 UTSW 3 144,778,005 (GRCm39) missense probably benign 0.00
R9261:Clca3a2 UTSW 3 144,525,158 (GRCm39) missense probably benign
R9469:Clca3a2 UTSW 3 144,507,938 (GRCm39) missense probably damaging 1.00
R9501:Clca3a2 UTSW 3 144,777,322 (GRCm39) nonsense probably null
R9515:Clca3a2 UTSW 3 144,508,808 (GRCm39) nonsense probably null
R9569:Clca3a2 UTSW 3 144,513,075 (GRCm39) critical splice donor site probably null
R9664:Clca3a2 UTSW 3 144,503,575 (GRCm39) missense probably damaging 1.00
X0025:Clca3a2 UTSW 3 144,792,265 (GRCm39) missense possibly damaging 0.87
Z1177:Clca3a2 UTSW 3 144,792,212 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCTGGGCCCATTGACATG -3'
(R):5'- GGCTTTGTATCAAAACAGTGTGACC -3'

Sequencing Primer
(F):5'- CTGGGCCCATTGACATGAATATTG -3'
(R):5'- ACAGTGTGACCTAGTGTTTAAGC -3'
Posted On 2015-04-17