Incidental Mutation 'R3952:Tmod1'
ID307984
Institutional Source Beutler Lab
Gene Symbol Tmod1
Ensembl Gene ENSMUSG00000028328
Gene Nametropomodulin 1
Synonymserythrocyte tropomodulin, E-Tmod
MMRRC Submission 040829-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3952 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location46038935-46116032 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46078315 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 41 (N41S)
Ref Sequence ENSEMBL: ENSMUSP00000103402 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107773] [ENSMUST00000156200]
Predicted Effect probably damaging
Transcript: ENSMUST00000107773
AA Change: N41S

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103402
Gene: ENSMUSG00000028328
AA Change: N41S

DomainStartEndE-ValueType
Pfam:Tropomodulin 3 143 6.3e-64 PFAM
PDB:1IO0|A 160 344 1e-115 PDB
SCOP:d1a4ya_ 181 312 3e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128689
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136553
Predicted Effect probably benign
Transcript: ENSMUST00000156200
Meta Mutation Damage Score 0.2916 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tropomodulin family. The encoded protein is an actin-capping protein that regulates tropomyosin by binding to its N-terminus, inhibiting depolymerization and elongation of the pointed end of actin filaments and thereby influencing the structure of the erythrocyte membrane skeleton. Multiple transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous inactivation of this locus results in aborted heart development and consequent embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik T C 10: 100,615,296 probably benign Het
4833423E24Rik T C 2: 85,500,204 probably benign Het
4932414N04Rik T C 2: 68,664,403 probably null Het
Abi3bp C T 16: 56,604,038 T450I possibly damaging Het
Abl1 A T 2: 31,784,537 T213S probably damaging Het
Apc2 C T 10: 80,314,484 R1762W probably damaging Het
Arl2 G T 19: 6,134,677 T182N probably benign Het
Brd8 C G 18: 34,614,444 probably benign Het
Cdh23 T C 10: 60,657,326 Y3C probably benign Het
Clca3a2 A G 3: 144,803,061 Y666H probably damaging Het
Cmya5 A G 13: 93,089,199 V3127A possibly damaging Het
Copg1 G A 6: 87,905,216 A598T probably benign Het
Dera A G 6: 137,837,120 Y100C probably damaging Het
Epha1 C A 6: 42,364,285 L535F probably damaging Het
Epha4 A T 1: 77,399,716 Y509N probably damaging Het
Ggcx G A 6: 72,426,558 G363R probably benign Het
Gm13101 C T 4: 143,965,786 W215* probably null Het
Hjurp G C 1: 88,277,215 probably benign Het
Kpna1 A T 16: 36,002,882 T35S probably benign Het
Map3k20 T G 2: 72,438,300 I550M probably damaging Het
Mgat4a A G 1: 37,450,414 probably benign Het
Mrpl48 T A 7: 100,559,923 probably benign Het
Ncapd2 T C 6: 125,186,784 K78E probably damaging Het
Ndst1 T C 18: 60,697,139 N633S probably benign Het
Olfr1128 T C 2: 87,545,065 T160A probably damaging Het
Olfr519 C A 7: 108,893,982 V142L probably benign Het
Olfr816 A G 10: 129,911,636 I214T probably benign Het
Pacs2 T C 12: 113,061,113 S408P probably damaging Het
Pcx C T 19: 4,617,967 H506Y probably benign Het
Pla2g6 G T 15: 79,313,096 P93T probably damaging Het
Prpmp5 G A 6: 132,312,694 P56S unknown Het
Rcor1 A G 12: 111,039,735 probably benign Het
Rtn4ip1 T A 10: 43,909,897 probably null Het
Sytl2 T A 7: 90,381,492 probably benign Het
Tia1 T C 6: 86,416,337 F53S probably damaging Het
Ticrr T C 7: 79,682,069 L776S probably damaging Het
Ttn T C 2: 76,752,795 I22585V possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ugt1a10 C A 1: 88,216,140 H361N probably damaging Het
Vmn1r118 G T 7: 20,912,008 Q114K probably damaging Het
Vps39 C T 2: 120,350,175 R43Q probably benign Het
Vwa5b2 T C 16: 20,598,361 *603Q probably null Het
Zeb1 G A 18: 5,772,716 A1002T probably benign Het
Zxdc A G 6: 90,370,467 probably null Het
Other mutations in Tmod1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03375:Tmod1 APN 4 46096999 missense probably damaging 1.00
R1445:Tmod1 UTSW 4 46090884 missense probably damaging 1.00
R1513:Tmod1 UTSW 4 46083549 missense possibly damaging 0.61
R1888:Tmod1 UTSW 4 46097069 synonymous silent
R1980:Tmod1 UTSW 4 46061043 missense probably damaging 1.00
R2914:Tmod1 UTSW 4 46092259 missense probably damaging 1.00
R3725:Tmod1 UTSW 4 46097026 missense probably benign 0.11
R3726:Tmod1 UTSW 4 46097026 missense probably benign 0.11
R4854:Tmod1 UTSW 4 46090920 missense possibly damaging 0.80
R4989:Tmod1 UTSW 4 46090872 missense probably damaging 0.97
R6254:Tmod1 UTSW 4 46078469 splice site probably null
R7212:Tmod1 UTSW 4 46093951 nonsense probably null
R7570:Tmod1 UTSW 4 46083632 missense probably benign 0.15
R7572:Tmod1 UTSW 4 46083593 missense possibly damaging 0.53
Z1176:Tmod1 UTSW 4 46092271 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTCCTTAAGTGCCCTGTGAC -3'
(R):5'- CCGTGCTGTTTAGTACCTCG -3'

Sequencing Primer
(F):5'- CTTGCAGGTTCCTTGCATAGAAAAGG -3'
(R):5'- CGTTTCTCCCCTGTGTAGG -3'
Posted On2015-04-17