Incidental Mutation 'R3952:Ggcx'
ID307988
Institutional Source Beutler Lab
Gene Symbol Ggcx
Ensembl Gene ENSMUSG00000053460
Gene Namegamma-glutamyl carboxylase
Synonymsvitamin K-dependent carboxylase
MMRRC Submission 040829-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.401) question?
Stock #R3952 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location72414308-72430712 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 72426558 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 363 (G363R)
Ref Sequence ENSEMBL: ENSMUSP00000070109 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065906] [ENSMUST00000205738]
Predicted Effect probably benign
Transcript: ENSMUST00000065906
AA Change: G363R

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000070109
Gene: ENSMUSG00000053460
AA Change: G363R

DomainStartEndE-ValueType
HTTM 56 315 1.34e-131 SMART
low complexity region 368 377 N/A INTRINSIC
low complexity region 630 645 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132995
Predicted Effect probably benign
Transcript: ENSMUST00000205738
Predicted Effect probably benign
Transcript: ENSMUST00000207000
Predicted Effect probably benign
Transcript: ENSMUST00000207012
Meta Mutation Damage Score 0.1159 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein of the rough endoplasmic reticulum that carboxylates glutamate residues of vitamin K-dependent proteins to gamma carboxyl glutamate, a modification that is required for their activity. The vitamin K-dependent protein substrates have a propeptide that binds the enzyme, with carbon dioxide, dioxide, and reduced vitamin K acting as co-substrates. Vitamin K-dependent proteins affect a number of physiologic processes including blood coagulation, prevention of vascular calcification, and inflammation. Allelic variants of this gene have been associated with pseudoxanthoma elasticum-like disorder with associated multiple coagulation factor deficiency. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Approximately 50% of embryos homozygous for a knock-out allele die between E9.5 and E18 while those surviving to term die of massive intra-abdominal hemorrhage shortly after birth with no evidence of ectopic calcification. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik T C 10: 100,615,296 probably benign Het
4833423E24Rik T C 2: 85,500,204 probably benign Het
4932414N04Rik T C 2: 68,664,403 probably null Het
Abi3bp C T 16: 56,604,038 T450I possibly damaging Het
Abl1 A T 2: 31,784,537 T213S probably damaging Het
Apc2 C T 10: 80,314,484 R1762W probably damaging Het
Arl2 G T 19: 6,134,677 T182N probably benign Het
Brd8 C G 18: 34,614,444 probably benign Het
Cdh23 T C 10: 60,657,326 Y3C probably benign Het
Clca3a2 A G 3: 144,803,061 Y666H probably damaging Het
Cmya5 A G 13: 93,089,199 V3127A possibly damaging Het
Copg1 G A 6: 87,905,216 A598T probably benign Het
Dera A G 6: 137,837,120 Y100C probably damaging Het
Epha1 C A 6: 42,364,285 L535F probably damaging Het
Epha4 A T 1: 77,399,716 Y509N probably damaging Het
Gm13101 C T 4: 143,965,786 W215* probably null Het
Hjurp G C 1: 88,277,215 probably benign Het
Kpna1 A T 16: 36,002,882 T35S probably benign Het
Map3k20 T G 2: 72,438,300 I550M probably damaging Het
Mgat4a A G 1: 37,450,414 probably benign Het
Mrpl48 T A 7: 100,559,923 probably benign Het
Ncapd2 T C 6: 125,186,784 K78E probably damaging Het
Ndst1 T C 18: 60,697,139 N633S probably benign Het
Olfr1128 T C 2: 87,545,065 T160A probably damaging Het
Olfr519 C A 7: 108,893,982 V142L probably benign Het
Olfr816 A G 10: 129,911,636 I214T probably benign Het
Pacs2 T C 12: 113,061,113 S408P probably damaging Het
Pcx C T 19: 4,617,967 H506Y probably benign Het
Pla2g6 G T 15: 79,313,096 P93T probably damaging Het
Prpmp5 G A 6: 132,312,694 P56S unknown Het
Rcor1 A G 12: 111,039,735 probably benign Het
Rtn4ip1 T A 10: 43,909,897 probably null Het
Sytl2 T A 7: 90,381,492 probably benign Het
Tia1 T C 6: 86,416,337 F53S probably damaging Het
Ticrr T C 7: 79,682,069 L776S probably damaging Het
Tmod1 A G 4: 46,078,315 N41S probably damaging Het
Ttn T C 2: 76,752,795 I22585V possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ugt1a10 C A 1: 88,216,140 H361N probably damaging Het
Vmn1r118 G T 7: 20,912,008 Q114K probably damaging Het
Vps39 C T 2: 120,350,175 R43Q probably benign Het
Vwa5b2 T C 16: 20,598,361 *603Q probably null Het
Zeb1 G A 18: 5,772,716 A1002T probably benign Het
Zxdc A G 6: 90,370,467 probably null Het
Other mutations in Ggcx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01657:Ggcx APN 6 72429958 unclassified probably null
IGL02373:Ggcx APN 6 72427919 missense probably damaging 1.00
IGL02589:Ggcx APN 6 72429148 missense probably damaging 1.00
IGL02634:Ggcx APN 6 72418303 missense probably damaging 1.00
IGL02661:Ggcx APN 6 72418360 missense possibly damaging 0.78
IGL02701:Ggcx APN 6 72418472 intron probably benign
R0503:Ggcx UTSW 6 72429157 frame shift probably null
R1034:Ggcx UTSW 6 72414831 missense probably damaging 1.00
R2219:Ggcx UTSW 6 72427982 missense probably benign 0.29
R3892:Ggcx UTSW 6 72418372 missense probably damaging 0.99
R3951:Ggcx UTSW 6 72426558 missense probably benign 0.01
R4320:Ggcx UTSW 6 72428820 missense probably benign 0.24
R4321:Ggcx UTSW 6 72428820 missense probably benign 0.24
R4322:Ggcx UTSW 6 72428820 missense probably benign 0.24
R4324:Ggcx UTSW 6 72428820 missense probably benign 0.24
R4782:Ggcx UTSW 6 72428892 missense probably benign 0.01
R5370:Ggcx UTSW 6 72425931 missense possibly damaging 0.69
R5523:Ggcx UTSW 6 72424034 missense probably damaging 1.00
R5902:Ggcx UTSW 6 72429996 missense possibly damaging 0.92
R6126:Ggcx UTSW 6 72417983 missense possibly damaging 0.57
R6199:Ggcx UTSW 6 72430139 missense possibly damaging 0.57
R6223:Ggcx UTSW 6 72429605 missense probably damaging 0.97
R6515:Ggcx UTSW 6 72425832 missense probably benign 0.33
R7205:Ggcx UTSW 6 72428004 missense probably damaging 1.00
R8034:Ggcx UTSW 6 72428604 missense possibly damaging 0.47
Z1177:Ggcx UTSW 6 72426519 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- ATGTTTCCCTATGTCATGCTGG -3'
(R):5'- TAACCCTGGGAAGACAGAGC -3'

Sequencing Primer
(F):5'- GCCAGCAGCCCTCTCTTCTG -3'
(R):5'- CACACAGCATTGGTTTAGTGC -3'
Posted On2015-04-17