Incidental Mutation 'R3952:Sytl2'
ID307997
Institutional Source Beutler Lab
Gene Symbol Sytl2
Ensembl Gene ENSMUSG00000030616
Gene Namesynaptotagmin-like 2
SynonymsSlp2-a, Slp2-b, Slp2-d, Slp2-c, Slp2
MMRRC Submission 040829-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.301) question?
Stock #R3952 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location90302252-90410719 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 90381492 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147191 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107210] [ENSMUST00000107211] [ENSMUST00000190731] [ENSMUST00000190837] [ENSMUST00000208720]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000098310
SMART Domains Protein: ENSMUSP00000095912
Gene: ENSMUSG00000030616

DomainStartEndE-ValueType
low complexity region 938 966 N/A INTRINSIC
C2 990 1095 4.59e-15 SMART
C2 1139 1242 6.44e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107210
SMART Domains Protein: ENSMUSP00000102828
Gene: ENSMUSG00000030616

DomainStartEndE-ValueType
Pfam:FYVE_2 5 59 5.5e-9 PFAM
low complexity region 192 205 N/A INTRINSIC
low complexity region 317 328 N/A INTRINSIC
C2 620 725 4.59e-15 SMART
C2 769 872 6.44e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107211
SMART Domains Protein: ENSMUSP00000102829
Gene: ENSMUSG00000030616

DomainStartEndE-ValueType
Pfam:FYVE_2 5 59 5.6e-9 PFAM
low complexity region 192 205 N/A INTRINSIC
low complexity region 317 328 N/A INTRINSIC
low complexity region 592 620 N/A INTRINSIC
C2 644 749 4.59e-15 SMART
C2 793 896 6.44e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190365
Predicted Effect probably benign
Transcript: ENSMUST00000190731
SMART Domains Protein: ENSMUSP00000139865
Gene: ENSMUSG00000030616

DomainStartEndE-ValueType
Pfam:FYVE_2 5 59 5.8e-9 PFAM
low complexity region 192 205 N/A INTRINSIC
low complexity region 317 328 N/A INTRINSIC
low complexity region 608 636 N/A INTRINSIC
C2 660 765 4.59e-15 SMART
C2 809 912 6.44e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190837
SMART Domains Protein: ENSMUSP00000139450
Gene: ENSMUSG00000030616

DomainStartEndE-ValueType
Pfam:FYVE_2 5 59 5.6e-9 PFAM
low complexity region 82 93 N/A INTRINSIC
low complexity region 165 178 N/A INTRINSIC
low complexity region 290 301 N/A INTRINSIC
low complexity region 581 609 N/A INTRINSIC
C2 633 738 4.59e-15 SMART
C2 782 885 6.44e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207431
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207455
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207629
Predicted Effect probably benign
Transcript: ENSMUST00000208720
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a synaptotagmin-like protein (SLP) that belongs to a C2 domain-containing protein family. The SLP homology domain (SHD) of this protein has been shown to specifically bind the GTP-bound form of Ras-related protein Rab-27A (RAB27A). This protein plays a role in RAB27A-dependent vesicle trafficking and controls melanosome distribution in the cell periphery. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Jun 2009]
PHENOTYPE: Mice homozygous for a null allele display abnormal gastric surface mucus cell morphology and reduced basal mucin secretion from gastric cells [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik T C 10: 100,615,296 probably benign Het
4833423E24Rik T C 2: 85,500,204 probably benign Het
4932414N04Rik T C 2: 68,664,403 probably null Het
Abi3bp C T 16: 56,604,038 T450I possibly damaging Het
Abl1 A T 2: 31,784,537 T213S probably damaging Het
Apc2 C T 10: 80,314,484 R1762W probably damaging Het
Arl2 G T 19: 6,134,677 T182N probably benign Het
Brd8 C G 18: 34,614,444 probably benign Het
Cdh23 T C 10: 60,657,326 Y3C probably benign Het
Clca3a2 A G 3: 144,803,061 Y666H probably damaging Het
Cmya5 A G 13: 93,089,199 V3127A possibly damaging Het
Copg1 G A 6: 87,905,216 A598T probably benign Het
Dera A G 6: 137,837,120 Y100C probably damaging Het
Epha1 C A 6: 42,364,285 L535F probably damaging Het
Epha4 A T 1: 77,399,716 Y509N probably damaging Het
Ggcx G A 6: 72,426,558 G363R probably benign Het
Gm13101 C T 4: 143,965,786 W215* probably null Het
Hjurp G C 1: 88,277,215 probably benign Het
Kpna1 A T 16: 36,002,882 T35S probably benign Het
Map3k20 T G 2: 72,438,300 I550M probably damaging Het
Mgat4a A G 1: 37,450,414 probably benign Het
Mrpl48 T A 7: 100,559,923 probably benign Het
Ncapd2 T C 6: 125,186,784 K78E probably damaging Het
Ndst1 T C 18: 60,697,139 N633S probably benign Het
Olfr1128 T C 2: 87,545,065 T160A probably damaging Het
Olfr519 C A 7: 108,893,982 V142L probably benign Het
Olfr816 A G 10: 129,911,636 I214T probably benign Het
Pacs2 T C 12: 113,061,113 S408P probably damaging Het
Pcx C T 19: 4,617,967 H506Y probably benign Het
Pla2g6 G T 15: 79,313,096 P93T probably damaging Het
Prpmp5 G A 6: 132,312,694 P56S unknown Het
Rcor1 A G 12: 111,039,735 probably benign Het
Rtn4ip1 T A 10: 43,909,897 probably null Het
Tia1 T C 6: 86,416,337 F53S probably damaging Het
Ticrr T C 7: 79,682,069 L776S probably damaging Het
Tmod1 A G 4: 46,078,315 N41S probably damaging Het
Ttn T C 2: 76,752,795 I22585V possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ugt1a10 C A 1: 88,216,140 H361N probably damaging Het
Vmn1r118 G T 7: 20,912,008 Q114K probably damaging Het
Vps39 C T 2: 120,350,175 R43Q probably benign Het
Vwa5b2 T C 16: 20,598,361 *603Q probably null Het
Zeb1 G A 18: 5,772,716 A1002T probably benign Het
Zxdc A G 6: 90,370,467 probably null Het
Other mutations in Sytl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Sytl2 APN 7 90372905 missense probably benign 0.25
IGL00657:Sytl2 APN 7 90401410 missense probably benign 0.40
IGL00788:Sytl2 APN 7 90382698 intron probably benign
IGL00834:Sytl2 APN 7 90382636 intron probably benign
IGL01833:Sytl2 APN 7 90396537 missense probably damaging 0.99
IGL01866:Sytl2 APN 7 90381839 intron probably benign
IGL02215:Sytl2 APN 7 90381214 intron probably benign
IGL02934:Sytl2 APN 7 90375992 missense probably benign 0.00
IGL03095:Sytl2 APN 7 90392434 missense probably damaging 1.00
finder UTSW 7 90375652 missense probably damaging 1.00
keeper UTSW 7 90358224 nonsense probably null
R0126:Sytl2 UTSW 7 90396589 missense probably damaging 1.00
R0269:Sytl2 UTSW 7 90403020 splice site probably benign
R0270:Sytl2 UTSW 7 90403020 splice site probably benign
R0271:Sytl2 UTSW 7 90403020 splice site probably benign
R0288:Sytl2 UTSW 7 90403020 splice site probably benign
R0528:Sytl2 UTSW 7 90403020 splice site probably benign
R0601:Sytl2 UTSW 7 90395166 missense probably damaging 1.00
R0610:Sytl2 UTSW 7 90380853 intron probably benign
R1634:Sytl2 UTSW 7 90395182 missense probably damaging 1.00
R1777:Sytl2 UTSW 7 90403052 missense probably benign 0.25
R2040:Sytl2 UTSW 7 90381861 intron probably benign
R3788:Sytl2 UTSW 7 90376081 missense probably benign 0.00
R3843:Sytl2 UTSW 7 90360159 missense possibly damaging 0.77
R4082:Sytl2 UTSW 7 90408427 missense possibly damaging 0.88
R4600:Sytl2 UTSW 7 90375769 missense probably benign 0.11
R4651:Sytl2 UTSW 7 90375425 missense probably damaging 1.00
R4724:Sytl2 UTSW 7 90348792 start codon destroyed probably null 1.00
R4730:Sytl2 UTSW 7 90381249 intron probably benign
R4870:Sytl2 UTSW 7 90388898 missense probably damaging 1.00
R4959:Sytl2 UTSW 7 90376037 missense probably damaging 0.97
R4995:Sytl2 UTSW 7 90382257 intron probably benign
R5009:Sytl2 UTSW 7 90381315 intron probably benign
R5096:Sytl2 UTSW 7 90376082 missense possibly damaging 0.49
R5191:Sytl2 UTSW 7 90375652 missense probably damaging 1.00
R5305:Sytl2 UTSW 7 90381863 intron probably benign
R5538:Sytl2 UTSW 7 90388906 missense probably benign 0.03
R5792:Sytl2 UTSW 7 90375689 missense probably damaging 0.98
R6378:Sytl2 UTSW 7 90358224 nonsense probably null
R6982:Sytl2 UTSW 7 90396564 missense probably damaging 0.96
R7456:Sytl2 UTSW 7 90348847 missense probably damaging 1.00
R7600:Sytl2 UTSW 7 90376144 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTCAGAGCAAGAGATTCAAGAATC -3'
(R):5'- GCTGAAGGACTGTGGTTCTC -3'

Sequencing Primer
(F):5'- CCATAGTGAAAACAAGCATTTTGCC -3'
(R):5'- CAAACAATAGGTCATCTTTAAGCGGG -3'
Posted On2015-04-17