Incidental Mutation 'R3952:Olfr519'
ID307998
Institutional Source Beutler Lab
Gene Symbol Olfr519
Ensembl Gene ENSMUSG00000066239
Gene Nameolfactory receptor 519
SynonymsGA_x6K02T2PBJ9-11224559-11223615, MOR268-6
MMRRC Submission 040829-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R3952 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location108893461-108894420 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 108893982 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 142 (V142L)
Ref Sequence ENSEMBL: ENSMUSP00000144271 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084752] [ENSMUST00000202706]
Predicted Effect probably benign
Transcript: ENSMUST00000084752
AA Change: V147L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000081804
Gene: ENSMUSG00000066239
AA Change: V147L

DomainStartEndE-ValueType
Pfam:7tm_4 36 313 1.3e-59 PFAM
Pfam:7TM_GPCR_Srsx 40 310 3.3e-6 PFAM
Pfam:7tm_1 46 305 3.7e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202706
AA Change: V142L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000144271
Gene: ENSMUSG00000066239
AA Change: V142L

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 4.1e-59 PFAM
Pfam:7TM_GPCR_Srsx 35 305 2.1e-5 PFAM
Pfam:7tm_1 41 300 1.2e-24 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik T C 10: 100,615,296 probably benign Het
4833423E24Rik T C 2: 85,500,204 probably benign Het
4932414N04Rik T C 2: 68,664,403 probably null Het
Abi3bp C T 16: 56,604,038 T450I possibly damaging Het
Abl1 A T 2: 31,784,537 T213S probably damaging Het
Apc2 C T 10: 80,314,484 R1762W probably damaging Het
Arl2 G T 19: 6,134,677 T182N probably benign Het
Brd8 C G 18: 34,614,444 probably benign Het
Cdh23 T C 10: 60,657,326 Y3C probably benign Het
Clca3a2 A G 3: 144,803,061 Y666H probably damaging Het
Cmya5 A G 13: 93,089,199 V3127A possibly damaging Het
Copg1 G A 6: 87,905,216 A598T probably benign Het
Dera A G 6: 137,837,120 Y100C probably damaging Het
Epha1 C A 6: 42,364,285 L535F probably damaging Het
Epha4 A T 1: 77,399,716 Y509N probably damaging Het
Ggcx G A 6: 72,426,558 G363R probably benign Het
Gm13101 C T 4: 143,965,786 W215* probably null Het
Hjurp G C 1: 88,277,215 probably benign Het
Kpna1 A T 16: 36,002,882 T35S probably benign Het
Map3k20 T G 2: 72,438,300 I550M probably damaging Het
Mgat4a A G 1: 37,450,414 probably benign Het
Mrpl48 T A 7: 100,559,923 probably benign Het
Ncapd2 T C 6: 125,186,784 K78E probably damaging Het
Ndst1 T C 18: 60,697,139 N633S probably benign Het
Olfr1128 T C 2: 87,545,065 T160A probably damaging Het
Olfr816 A G 10: 129,911,636 I214T probably benign Het
Pacs2 T C 12: 113,061,113 S408P probably damaging Het
Pcx C T 19: 4,617,967 H506Y probably benign Het
Pla2g6 G T 15: 79,313,096 P93T probably damaging Het
Prpmp5 G A 6: 132,312,694 P56S unknown Het
Rcor1 A G 12: 111,039,735 probably benign Het
Rtn4ip1 T A 10: 43,909,897 probably null Het
Sytl2 T A 7: 90,381,492 probably benign Het
Tia1 T C 6: 86,416,337 F53S probably damaging Het
Ticrr T C 7: 79,682,069 L776S probably damaging Het
Tmod1 A G 4: 46,078,315 N41S probably damaging Het
Ttn T C 2: 76,752,795 I22585V possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ugt1a10 C A 1: 88,216,140 H361N probably damaging Het
Vmn1r118 G T 7: 20,912,008 Q114K probably damaging Het
Vps39 C T 2: 120,350,175 R43Q probably benign Het
Vwa5b2 T C 16: 20,598,361 *603Q probably null Het
Zeb1 G A 18: 5,772,716 A1002T probably benign Het
Zxdc A G 6: 90,370,467 probably null Het
Other mutations in Olfr519
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Olfr519 APN 7 108894085 missense probably benign 0.22
IGL02043:Olfr519 APN 7 108893839 nonsense probably null
PIT4382001:Olfr519 UTSW 7 108894102 missense probably damaging 1.00
R1183:Olfr519 UTSW 7 108893741 missense probably damaging 1.00
R1596:Olfr519 UTSW 7 108893879 missense probably damaging 1.00
R1647:Olfr519 UTSW 7 108893765 missense probably damaging 1.00
R1648:Olfr519 UTSW 7 108893765 missense probably damaging 1.00
R4611:Olfr519 UTSW 7 108894117 missense probably damaging 1.00
R4723:Olfr519 UTSW 7 108893821 missense probably benign 0.09
R5838:Olfr519 UTSW 7 108894085 missense probably benign 0.22
R6483:Olfr519 UTSW 7 108894111 missense possibly damaging 0.76
R6516:Olfr519 UTSW 7 108893765 missense probably damaging 1.00
R7353:Olfr519 UTSW 7 108894222 missense probably damaging 1.00
R7748:Olfr519 UTSW 7 108894078 missense probably benign 0.22
R7975:Olfr519 UTSW 7 108893812 nonsense probably null
Z1088:Olfr519 UTSW 7 108893773 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAAATGGTGCTTGTGAAGGC -3'
(R):5'- GTTTCAGCACAGTCATCACAC -3'

Sequencing Primer
(F):5'- TGCTTGTGAAGGCATAGACTTC -3'
(R):5'- CCTGAAATACTGGTGATCCTGAC -3'
Posted On2015-04-17