Incidental Mutation 'R3952:Rcor1'
ID308008
Institutional Source Beutler Lab
Gene Symbol Rcor1
Ensembl Gene ENSMUSG00000037896
Gene NameREST corepressor 1
Synonyms6720480E22Rik, D12Wsu95e, Rocr1
MMRRC Submission 040829-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3952 (G1)
Quality Score129
Status Not validated
Chromosome12
Chromosomal Location111039351-111115901 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 111039735 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084968] [ENSMUST00000116388]
Predicted Effect unknown
Transcript: ENSMUST00000084968
AA Change: T44A
SMART Domains Protein: ENSMUSP00000082034
Gene: ENSMUSG00000037896
AA Change: T44A

DomainStartEndE-ValueType
low complexity region 21 58 N/A INTRINSIC
low complexity region 66 98 N/A INTRINSIC
ELM2 99 154 1.12e-14 SMART
SANT 185 233 4.49e-7 SMART
low complexity region 250 260 N/A INTRINSIC
low complexity region 318 331 N/A INTRINSIC
SANT 376 424 2.52e-10 SMART
low complexity region 453 465 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000116388
SMART Domains Protein: ENSMUSP00000112089
Gene: ENSMUSG00000037896

DomainStartEndE-ValueType
ELM2 1 56 1.12e-14 SMART
SANT 87 135 4.49e-7 SMART
low complexity region 152 162 N/A INTRINSIC
coiled coil region 230 265 N/A INTRINSIC
SANT 278 326 2.52e-10 SMART
low complexity region 355 367 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is well-conserved, downregulated at birth, and with a specific role in determining neural cell differentiation. The encoded protein binds to the C-terminal domain of REST (repressor element-1 silencing transcription factor). [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit partial embryonic lethality, defective embryonic erythropoiesis, and decreased erythroid progenitor cell number. No homozygotes survive to P7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik T C 10: 100,615,296 probably benign Het
4833423E24Rik T C 2: 85,500,204 probably benign Het
4932414N04Rik T C 2: 68,664,403 probably null Het
Abi3bp C T 16: 56,604,038 T450I possibly damaging Het
Abl1 A T 2: 31,784,537 T213S probably damaging Het
Apc2 C T 10: 80,314,484 R1762W probably damaging Het
Arl2 G T 19: 6,134,677 T182N probably benign Het
Brd8 C G 18: 34,614,444 probably benign Het
Cdh23 T C 10: 60,657,326 Y3C probably benign Het
Clca3a2 A G 3: 144,803,061 Y666H probably damaging Het
Cmya5 A G 13: 93,089,199 V3127A possibly damaging Het
Copg1 G A 6: 87,905,216 A598T probably benign Het
Dera A G 6: 137,837,120 Y100C probably damaging Het
Epha1 C A 6: 42,364,285 L535F probably damaging Het
Epha4 A T 1: 77,399,716 Y509N probably damaging Het
Ggcx G A 6: 72,426,558 G363R probably benign Het
Gm13101 C T 4: 143,965,786 W215* probably null Het
Hjurp G C 1: 88,277,215 probably benign Het
Kpna1 A T 16: 36,002,882 T35S probably benign Het
Map3k20 T G 2: 72,438,300 I550M probably damaging Het
Mgat4a A G 1: 37,450,414 probably benign Het
Mrpl48 T A 7: 100,559,923 probably benign Het
Ncapd2 T C 6: 125,186,784 K78E probably damaging Het
Ndst1 T C 18: 60,697,139 N633S probably benign Het
Olfr1128 T C 2: 87,545,065 T160A probably damaging Het
Olfr519 C A 7: 108,893,982 V142L probably benign Het
Olfr816 A G 10: 129,911,636 I214T probably benign Het
Pacs2 T C 12: 113,061,113 S408P probably damaging Het
Pcx C T 19: 4,617,967 H506Y probably benign Het
Pla2g6 G T 15: 79,313,096 P93T probably damaging Het
Prpmp5 G A 6: 132,312,694 P56S unknown Het
Rtn4ip1 T A 10: 43,909,897 probably null Het
Sytl2 T A 7: 90,381,492 probably benign Het
Tia1 T C 6: 86,416,337 F53S probably damaging Het
Ticrr T C 7: 79,682,069 L776S probably damaging Het
Tmod1 A G 4: 46,078,315 N41S probably damaging Het
Ttn T C 2: 76,752,795 I22585V possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ugt1a10 C A 1: 88,216,140 H361N probably damaging Het
Vmn1r118 G T 7: 20,912,008 Q114K probably damaging Het
Vps39 C T 2: 120,350,175 R43Q probably benign Het
Vwa5b2 T C 16: 20,598,361 *603Q probably null Het
Zeb1 G A 18: 5,772,716 A1002T probably benign Het
Zxdc A G 6: 90,370,467 probably null Het
Other mutations in Rcor1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01869:Rcor1 APN 12 111103759 missense possibly damaging 0.92
R0103:Rcor1 UTSW 12 111109778 splice site probably benign
R0103:Rcor1 UTSW 12 111109778 splice site probably benign
R0504:Rcor1 UTSW 12 111101668 missense probably benign 0.03
R1506:Rcor1 UTSW 12 111109837 missense probably damaging 1.00
R1540:Rcor1 UTSW 12 111103603 splice site probably benign
R2356:Rcor1 UTSW 12 111109792 missense probably damaging 0.99
R3882:Rcor1 UTSW 12 111103753 missense probably damaging 1.00
R4881:Rcor1 UTSW 12 111097552 missense probably damaging 1.00
R5718:Rcor1 UTSW 12 111101635 missense probably benign 0.13
R6250:Rcor1 UTSW 12 111111877 missense probably benign 0.00
R6798:Rcor1 UTSW 12 111039886 splice site probably benign
R6901:Rcor1 UTSW 12 111108888 missense probably damaging 0.97
R7538:Rcor1 UTSW 12 111067837 intron probably null
R7761:Rcor1 UTSW 12 111109863 missense
X0027:Rcor1 UTSW 12 111040001 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGAGAGCCAAAGTTGCGCTC -3'
(R):5'- GCTACTCACCAGGATCGAAG -3'

Sequencing Primer
(F):5'- AAAGTTGCGCTCCGTTCG -3'
(R):5'- TCACCAGGATCGAAGTCGGG -3'
Posted On2015-04-17