Incidental Mutation 'R3952:Pacs2'
ID308009
Institutional Source Beutler Lab
Gene Symbol Pacs2
Ensembl Gene ENSMUSG00000021143
Gene Namephosphofurin acidic cluster sorting protein 2
Synonyms6720425G15Rik, Pacs1l
MMRRC Submission 040829-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3952 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location113014508-113074401 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 113061113 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 408 (S408P)
Ref Sequence ENSEMBL: ENSMUSP00000152145 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084891] [ENSMUST00000220541] [ENSMUST00000223502]
Predicted Effect probably damaging
Transcript: ENSMUST00000084891
AA Change: S438P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000081953
Gene: ENSMUSG00000021143
AA Change: S438P

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
low complexity region 199 213 N/A INTRINSIC
low complexity region 281 296 N/A INTRINSIC
low complexity region 299 313 N/A INTRINSIC
Pfam:Pacs-1 474 888 1.4e-208 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197963
Predicted Effect probably damaging
Transcript: ENSMUST00000220541
AA Change: S408P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220715
Predicted Effect probably damaging
Transcript: ENSMUST00000223502
AA Change: S438P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Meta Mutation Damage Score 0.1097 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (46/47)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit decreased sensitivity to TRAIL-induced spleen apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik T C 10: 100,615,296 probably benign Het
4833423E24Rik T C 2: 85,500,204 probably benign Het
4932414N04Rik T C 2: 68,664,403 probably null Het
Abi3bp C T 16: 56,604,038 T450I possibly damaging Het
Abl1 A T 2: 31,784,537 T213S probably damaging Het
Apc2 C T 10: 80,314,484 R1762W probably damaging Het
Arl2 G T 19: 6,134,677 T182N probably benign Het
Brd8 C G 18: 34,614,444 probably benign Het
Cdh23 T C 10: 60,657,326 Y3C probably benign Het
Clca3a2 A G 3: 144,803,061 Y666H probably damaging Het
Cmya5 A G 13: 93,089,199 V3127A possibly damaging Het
Copg1 G A 6: 87,905,216 A598T probably benign Het
Dera A G 6: 137,837,120 Y100C probably damaging Het
Epha1 C A 6: 42,364,285 L535F probably damaging Het
Epha4 A T 1: 77,399,716 Y509N probably damaging Het
Ggcx G A 6: 72,426,558 G363R probably benign Het
Gm13101 C T 4: 143,965,786 W215* probably null Het
Hjurp G C 1: 88,277,215 probably benign Het
Kpna1 A T 16: 36,002,882 T35S probably benign Het
Map3k20 T G 2: 72,438,300 I550M probably damaging Het
Mgat4a A G 1: 37,450,414 probably benign Het
Mrpl48 T A 7: 100,559,923 probably benign Het
Ncapd2 T C 6: 125,186,784 K78E probably damaging Het
Ndst1 T C 18: 60,697,139 N633S probably benign Het
Olfr1128 T C 2: 87,545,065 T160A probably damaging Het
Olfr519 C A 7: 108,893,982 V142L probably benign Het
Olfr816 A G 10: 129,911,636 I214T probably benign Het
Pcx C T 19: 4,617,967 H506Y probably benign Het
Pla2g6 G T 15: 79,313,096 P93T probably damaging Het
Prpmp5 G A 6: 132,312,694 P56S unknown Het
Rcor1 A G 12: 111,039,735 probably benign Het
Rtn4ip1 T A 10: 43,909,897 probably null Het
Sytl2 T A 7: 90,381,492 probably benign Het
Tia1 T C 6: 86,416,337 F53S probably damaging Het
Ticrr T C 7: 79,682,069 L776S probably damaging Het
Tmod1 A G 4: 46,078,315 N41S probably damaging Het
Ttn T C 2: 76,752,795 I22585V possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ugt1a10 C A 1: 88,216,140 H361N probably damaging Het
Vmn1r118 G T 7: 20,912,008 Q114K probably damaging Het
Vps39 C T 2: 120,350,175 R43Q probably benign Het
Vwa5b2 T C 16: 20,598,361 *603Q probably null Het
Zeb1 G A 18: 5,772,716 A1002T probably benign Het
Zxdc A G 6: 90,370,467 probably null Het
Other mutations in Pacs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01774:Pacs2 APN 12 113056842 missense probably benign 0.01
IGL01830:Pacs2 APN 12 113056954 nonsense probably null
IGL02229:Pacs2 APN 12 113056800 splice site probably benign
IGL02307:Pacs2 APN 12 113070773 missense probably damaging 1.00
IGL02700:Pacs2 APN 12 113061710 missense probably damaging 1.00
R0241:Pacs2 UTSW 12 113069270 splice site probably benign
R0433:Pacs2 UTSW 12 113056844 missense possibly damaging 0.77
R0512:Pacs2 UTSW 12 113050927 missense probably damaging 0.99
R0761:Pacs2 UTSW 12 113060068 splice site probably benign
R2017:Pacs2 UTSW 12 113062457 missense probably damaging 1.00
R2070:Pacs2 UTSW 12 113061111 missense probably damaging 1.00
R2162:Pacs2 UTSW 12 113050947 missense probably benign
R2231:Pacs2 UTSW 12 113063367 missense probably damaging 1.00
R2232:Pacs2 UTSW 12 113063367 missense probably damaging 1.00
R2396:Pacs2 UTSW 12 113063367 missense probably damaging 1.00
R2397:Pacs2 UTSW 12 113063367 missense probably damaging 1.00
R3010:Pacs2 UTSW 12 113061080 missense probably benign
R3403:Pacs2 UTSW 12 113050950 missense probably damaging 1.00
R3950:Pacs2 UTSW 12 113061113 missense probably damaging 1.00
R4518:Pacs2 UTSW 12 113060669 missense probably benign 0.31
R5673:Pacs2 UTSW 12 113068998 missense probably damaging 1.00
R5693:Pacs2 UTSW 12 113049906 missense probably damaging 1.00
R7212:Pacs2 UTSW 12 113061692 missense possibly damaging 0.77
R8032:Pacs2 UTSW 12 113061658 missense probably damaging 1.00
Z1177:Pacs2 UTSW 12 113070730 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGGGAGATTTCAGTGTCACC -3'
(R):5'- TCCTGACAAGAGGACCTATGAC -3'

Sequencing Primer
(F):5'- GAGATTTCAGTGTCACCTCACAGG -3'
(R):5'- GACAAGAGGACCTATGACTGTCTTC -3'
Posted On2015-04-17