Incidental Mutation 'R3952:Pla2g6'
ID308011
Institutional Source Beutler Lab
Gene Symbol Pla2g6
Ensembl Gene ENSMUSG00000042632
Gene Namephospholipase A2, group VI
SynonymsiPLA2beta, iPLA2
MMRRC Submission 040829-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3952 (G1)
Quality Score203
Status Not validated
Chromosome15
Chromosomal Location79286228-79328390 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 79313096 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 93 (P93T)
Ref Sequence ENSEMBL: ENSMUSP00000134672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047816] [ENSMUST00000166977] [ENSMUST00000172403] [ENSMUST00000172936] [ENSMUST00000173109] [ENSMUST00000173163] [ENSMUST00000173632] [ENSMUST00000174021]
Predicted Effect probably damaging
Transcript: ENSMUST00000047816
AA Change: P93T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044234
Gene: ENSMUSG00000042632
AA Change: P93T

DomainStartEndE-ValueType
low complexity region 96 109 N/A INTRINSIC
ANK 151 181 2.97e-3 SMART
ANK 185 215 4.6e0 SMART
ANK 219 248 3.23e-4 SMART
ANK 286 312 1.52e0 SMART
ANK 316 345 6.46e-4 SMART
ANK 349 378 2.02e-5 SMART
Pfam:Patatin 427 611 6.7e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000166977
AA Change: P93T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132071
Gene: ENSMUSG00000042632
AA Change: P93T

DomainStartEndE-ValueType
low complexity region 96 109 N/A INTRINSIC
ANK 151 181 2.97e-3 SMART
ANK 185 215 4.6e0 SMART
ANK 219 248 3.23e-4 SMART
ANK 286 312 1.52e0 SMART
ANK 316 345 6.46e-4 SMART
ANK 349 378 2.02e-5 SMART
Pfam:Patatin 427 611 6.7e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172403
AA Change: P93T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131081
Gene: ENSMUSG00000042632
AA Change: P93T

DomainStartEndE-ValueType
low complexity region 96 109 N/A INTRINSIC
ANK 151 181 2.97e-3 SMART
ANK 185 215 4.6e0 SMART
ANK 219 248 3.23e-4 SMART
ANK 286 312 1.52e0 SMART
ANK 316 345 6.46e-4 SMART
ANK 349 378 2.02e-5 SMART
Pfam:Patatin 427 611 6.7e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172936
Predicted Effect probably damaging
Transcript: ENSMUST00000173109
AA Change: P93T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133554
Gene: ENSMUSG00000042632
AA Change: P93T

DomainStartEndE-ValueType
low complexity region 96 109 N/A INTRINSIC
ANK 151 181 2.97e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000173163
AA Change: P93T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134456
Gene: ENSMUSG00000042632
AA Change: P93T

DomainStartEndE-ValueType
low complexity region 96 109 N/A INTRINSIC
ANK 151 181 2.97e-3 SMART
ANK 185 215 4.6e0 SMART
ANK 219 248 3.23e-4 SMART
ANK 286 312 1.52e0 SMART
ANK 316 345 6.46e-4 SMART
ANK 349 378 2.02e-5 SMART
Pfam:Patatin 427 611 6.7e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173178
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173601
Predicted Effect probably damaging
Transcript: ENSMUST00000173632
AA Change: P93T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133998
Gene: ENSMUSG00000042632
AA Change: P93T

DomainStartEndE-ValueType
low complexity region 96 109 N/A INTRINSIC
ANK 151 181 2.97e-3 SMART
Blast:ANK 185 204 7e-6 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000174021
AA Change: P93T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134672
Gene: ENSMUSG00000042632
AA Change: P93T

DomainStartEndE-ValueType
low complexity region 96 109 N/A INTRINSIC
ANK 151 181 2.97e-3 SMART
ANK 185 215 4.6e0 SMART
ANK 219 248 3.23e-4 SMART
ANK 286 312 1.52e0 SMART
ANK 316 345 6.46e-4 SMART
ANK 349 378 2.02e-5 SMART
Blast:ANK 382 411 2e-8 BLAST
Pfam:Patatin 482 666 2.9e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174089
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an A2 phospholipase, a class of enzyme that catalyzes the release of fatty acids from phospholipids. The encoded protein may play a role in phospholipid remodelling, arachidonic acid release, leukotriene and prostaglandin synthesis, fas-mediated apoptosis, and transmembrane ion flux in glucose-stimulated B-cells. Several transcript variants encoding multiple isoforms have been described, but the full-length nature of only three of them have been determined to date. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygous null mice display impaired male fertility and asthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik T C 10: 100,615,296 probably benign Het
4833423E24Rik T C 2: 85,500,204 probably benign Het
4932414N04Rik T C 2: 68,664,403 probably null Het
Abi3bp C T 16: 56,604,038 T450I possibly damaging Het
Abl1 A T 2: 31,784,537 T213S probably damaging Het
Apc2 C T 10: 80,314,484 R1762W probably damaging Het
Arl2 G T 19: 6,134,677 T182N probably benign Het
Brd8 C G 18: 34,614,444 probably benign Het
Cdh23 T C 10: 60,657,326 Y3C probably benign Het
Clca3a2 A G 3: 144,803,061 Y666H probably damaging Het
Cmya5 A G 13: 93,089,199 V3127A possibly damaging Het
Copg1 G A 6: 87,905,216 A598T probably benign Het
Dera A G 6: 137,837,120 Y100C probably damaging Het
Epha1 C A 6: 42,364,285 L535F probably damaging Het
Epha4 A T 1: 77,399,716 Y509N probably damaging Het
Ggcx G A 6: 72,426,558 G363R probably benign Het
Gm13101 C T 4: 143,965,786 W215* probably null Het
Hjurp G C 1: 88,277,215 probably benign Het
Kpna1 A T 16: 36,002,882 T35S probably benign Het
Map3k20 T G 2: 72,438,300 I550M probably damaging Het
Mgat4a A G 1: 37,450,414 probably benign Het
Mrpl48 T A 7: 100,559,923 probably benign Het
Ncapd2 T C 6: 125,186,784 K78E probably damaging Het
Ndst1 T C 18: 60,697,139 N633S probably benign Het
Olfr1128 T C 2: 87,545,065 T160A probably damaging Het
Olfr519 C A 7: 108,893,982 V142L probably benign Het
Olfr816 A G 10: 129,911,636 I214T probably benign Het
Pacs2 T C 12: 113,061,113 S408P probably damaging Het
Pcx C T 19: 4,617,967 H506Y probably benign Het
Prpmp5 G A 6: 132,312,694 P56S unknown Het
Rcor1 A G 12: 111,039,735 probably benign Het
Rtn4ip1 T A 10: 43,909,897 probably null Het
Sytl2 T A 7: 90,381,492 probably benign Het
Tia1 T C 6: 86,416,337 F53S probably damaging Het
Ticrr T C 7: 79,682,069 L776S probably damaging Het
Tmod1 A G 4: 46,078,315 N41S probably damaging Het
Ttn T C 2: 76,752,795 I22585V possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ugt1a10 C A 1: 88,216,140 H361N probably damaging Het
Vmn1r118 G T 7: 20,912,008 Q114K probably damaging Het
Vps39 C T 2: 120,350,175 R43Q probably benign Het
Vwa5b2 T C 16: 20,598,361 *603Q probably null Het
Zeb1 G A 18: 5,772,716 A1002T probably benign Het
Zxdc A G 6: 90,370,467 probably null Het
Other mutations in Pla2g6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Pla2g6 APN 15 79289241 missense probably damaging 0.96
IGL00906:Pla2g6 APN 15 79287747 missense probably damaging 1.00
IGL01432:Pla2g6 APN 15 79317968 start codon destroyed probably null 1.00
IGL01640:Pla2g6 APN 15 79304313 missense probably benign
IGL01715:Pla2g6 APN 15 79317857 missense probably benign 0.00
IGL01943:Pla2g6 APN 15 79313116 missense probably null 0.00
IGL02551:Pla2g6 APN 15 79299094 missense possibly damaging 0.95
IGL03120:Pla2g6 APN 15 79286860 missense probably damaging 1.00
IGL03193:Pla2g6 APN 15 79317785 missense probably damaging 0.98
IGL03194:Pla2g6 APN 15 79317785 missense probably damaging 0.98
IGL03205:Pla2g6 APN 15 79317785 missense probably damaging 0.98
IGL03289:Pla2g6 APN 15 79317785 missense probably damaging 0.98
R0288:Pla2g6 UTSW 15 79286906 splice site probably benign
R0631:Pla2g6 UTSW 15 79306396 missense probably damaging 1.00
R1216:Pla2g6 UTSW 15 79306435 missense probably benign 0.18
R1617:Pla2g6 UTSW 15 79289141 missense probably benign 0.03
R1785:Pla2g6 UTSW 15 79306345 missense probably benign 0.02
R2025:Pla2g6 UTSW 15 79286764 missense probably damaging 1.00
R2079:Pla2g6 UTSW 15 79312994 missense probably damaging 1.00
R4774:Pla2g6 UTSW 15 79287618 missense probably damaging 1.00
R4826:Pla2g6 UTSW 15 79308679 missense possibly damaging 0.96
R5093:Pla2g6 UTSW 15 79287128 missense probably benign 0.12
R5327:Pla2g6 UTSW 15 79302637 missense probably benign 0.03
R5390:Pla2g6 UTSW 15 79289693 missense possibly damaging 0.72
R5419:Pla2g6 UTSW 15 79299142 missense possibly damaging 0.82
R5432:Pla2g6 UTSW 15 79302617 critical splice donor site probably null
R5633:Pla2g6 UTSW 15 79299142 missense possibly damaging 0.82
R5829:Pla2g6 UTSW 15 79287693 missense possibly damaging 0.73
R5930:Pla2g6 UTSW 15 79303528 intron probably benign
R6228:Pla2g6 UTSW 15 79305724 missense probably benign 0.00
R6241:Pla2g6 UTSW 15 79304392 missense probably benign 0.02
R6339:Pla2g6 UTSW 15 79308816 missense probably damaging 0.99
R6485:Pla2g6 UTSW 15 79307372 missense probably benign 0.00
R6754:Pla2g6 UTSW 15 79306310 missense probably benign 0.01
R7419:Pla2g6 UTSW 15 79305698 splice site probably null
R7425:Pla2g6 UTSW 15 79308733 missense probably damaging 1.00
R7710:Pla2g6 UTSW 15 79287158 missense probably damaging 0.98
R7738:Pla2g6 UTSW 15 79297433 nonsense probably null
R7768:Pla2g6 UTSW 15 79297314 missense probably damaging 1.00
R7796:Pla2g6 UTSW 15 79317825 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- TCATTGGAAGAACAAGGGCC -3'
(R):5'- AAGCAAGCTCTGTTCTGAGG -3'

Sequencing Primer
(F):5'- AGGCAGCATGGACAGCC -3'
(R):5'- CTTCCAACTGGAGTCTGA -3'
Posted On2015-04-17