Mutagenetix > Incidental Mutation

Incidental Mutation 'R3952:Ndst1'

308016

Institutional Source

Beutler Lab

Gene Symbol

Ndst1

Ensembl Gene

ENSMUSG00000054008

Gene Name

N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1

Synonyms

glucosaminyl N-deacetylase/N-sulfotransferase 1, b2b2230Clo, Hsst, Ndst-1, 1200015G06Rik

MMRRC Submission

040829-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3952 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

60685978-60713389 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 60697139 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 633 (N633S)

Ref Sequence

ENSEMBL: ENSMUSP00000126623 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000169273]

AlphaFold

Q3UHN9

Predicted Effect

probably benign
Transcript: ENSMUST00000169273
AA Change: N633S

PolyPhen 2 Score 0.118 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000126623
Gene: ENSMUSG00000054008
AA Change: N633S

Domain	Start	End	E-Value	Type
low complexity region	3	12	N/A	INTRINSIC
Pfam:HSNSD	25	515	5.1e-254	PFAM
Pfam:Sulfotransfer_1	604	869	2.2e-48	PFAM

Meta Mutation Damage Score

0.1548

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

98% (46/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the heparan sulfate/heparin GlcNAc N-deacetylase/ N-sulfotransferase family. The encoded enzyme is a type II transmembrane protein that resides in the Golgi apparatus. The encoded protein catalyzes the transfer of sulfate from 3'-phosphoadenosine 5'-phosphosulfate to nitrogen of glucosamine in heparan sulfate. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene die late in gestation or neonatally. Lungs fail to inflate and mice born alive experience respiratory distress and failure. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017N19Rik	T	C	10: 100,615,296		probably benign	Het
4833423E24Rik	T	C	2: 85,500,204		probably benign	Het
4932414N04Rik	T	C	2: 68,664,403		probably null	Het
Abi3bp	C	T	16: 56,604,038	T450I	possibly damaging	Het
Abl1	A	T	2: 31,784,537	T213S	probably damaging	Het
Apc2	C	T	10: 80,314,484	R1762W	probably damaging	Het
Arl2	G	T	19: 6,134,677	T182N	probably benign	Het
Brd8	C	G	18: 34,614,444		probably benign	Het
Cdh23	T	C	10: 60,657,326	Y3C	probably benign	Het
Clca3a2	A	G	3: 144,803,061	Y666H	probably damaging	Het
Cmya5	A	G	13: 93,089,199	V3127A	possibly damaging	Het
Copg1	G	A	6: 87,905,216	A598T	probably benign	Het
Dera	A	G	6: 137,837,120	Y100C	probably damaging	Het
Epha1	C	A	6: 42,364,285	L535F	probably damaging	Het
Epha4	A	T	1: 77,399,716	Y509N	probably damaging	Het
Ggcx	G	A	6: 72,426,558	G363R	probably benign	Het
Gm13101	C	T	4: 143,965,786	W215*	probably null	Het
Hjurp	G	C	1: 88,277,215		probably benign	Het
Kpna1	A	T	16: 36,002,882	T35S	probably benign	Het
Map3k20	T	G	2: 72,438,300	I550M	probably damaging	Het
Mgat4a	A	G	1: 37,450,414		probably benign	Het
Mrpl48	T	A	7: 100,559,923		probably benign	Het
Ncapd2	T	C	6: 125,186,784	K78E	probably damaging	Het
Olfr1128	T	C	2: 87,545,065	T160A	probably damaging	Het
Olfr519	C	A	7: 108,893,982	V142L	probably benign	Het
Olfr816	A	G	10: 129,911,636	I214T	probably benign	Het
Pacs2	T	C	12: 113,061,113	S408P	probably damaging	Het
Pcx	C	T	19: 4,617,967	H506Y	probably benign	Het
Pla2g6	G	T	15: 79,313,096	P93T	probably damaging	Het
Prpmp5	G	A	6: 132,312,694	P56S	unknown	Het
Rcor1	A	G	12: 111,039,735		probably benign	Het
Rtn4ip1	T	A	10: 43,909,897		probably null	Het
Sytl2	T	A	7: 90,381,492		probably benign	Het
Tia1	T	C	6: 86,416,337	F53S	probably damaging	Het
Ticrr	T	C	7: 79,682,069	L776S	probably damaging	Het
Tmod1	A	G	4: 46,078,315	N41S	probably damaging	Het
Ttn	T	C	2: 76,752,795	I22585V	possibly damaging	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Ugt1a10	C	A	1: 88,216,140	H361N	probably damaging	Het
Vmn1r118	G	T	7: 20,912,008	Q114K	probably damaging	Het
Vps39	C	T	2: 120,350,175	R43Q	probably benign	Het
Vwa5b2	T	C	16: 20,598,361	*603Q	probably null	Het
Zeb1	G	A	18: 5,772,716	A1002T	probably benign	Het
Zxdc	A	G	6: 90,370,467		probably null	Het

Other mutations in Ndst1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Ndst1	APN	18	60707956	missense	probably damaging	1.00
IGL01410:Ndst1	APN	18	60700445	missense	probably damaging	1.00
IGL01578:Ndst1	APN	18	60713126	missense	probably damaging	1.00
IGL02133:Ndst1	APN	18	60699546	missense	probably benign	0.05
IGL03200:Ndst1	APN	18	60699539	missense	possibly damaging	0.86
R0631:Ndst1	UTSW	18	60700359	splice site	probably benign
R0899:Ndst1	UTSW	18	60707882	missense	probably benign	0.00
R1104:Ndst1	UTSW	18	60697146	missense	probably damaging	0.98
R1371:Ndst1	UTSW	18	60707647	missense	possibly damaging	0.90
R1456:Ndst1	UTSW	18	60713205	missense	possibly damaging	0.73
R1511:Ndst1	UTSW	18	60697170	missense	possibly damaging	0.61
R1524:Ndst1	UTSW	18	60698504	missense	probably damaging	0.99
R1699:Ndst1	UTSW	18	60695508	missense	probably damaging	1.00
R1718:Ndst1	UTSW	18	60707803	missense	probably damaging	0.99
R1772:Ndst1	UTSW	18	60702837	missense	probably damaging	0.99
R1900:Ndst1	UTSW	18	60712721	critical splice donor site	probably null
R2079:Ndst1	UTSW	18	60695509	missense	probably damaging	1.00
R2105:Ndst1	UTSW	18	60691253	missense	probably benign	0.01
R2127:Ndst1	UTSW	18	60691208	missense	probably benign	0.00
R2875:Ndst1	UTSW	18	60690047	missense	probably damaging	1.00
R3798:Ndst1	UTSW	18	60713166	missense	possibly damaging	0.94
R3950:Ndst1	UTSW	18	60697139	missense	probably benign	0.12
R3951:Ndst1	UTSW	18	60697139	missense	probably benign	0.12
R4868:Ndst1	UTSW	18	60695476	missense	probably benign	0.07
R4898:Ndst1	UTSW	18	60691987	missense	probably benign	0.12
R4988:Ndst1	UTSW	18	60702933	missense	probably damaging	0.99
R5271:Ndst1	UTSW	18	60705132	missense	probably benign	0.03
R5337:Ndst1	UTSW	18	60690007	missense	probably damaging	1.00
R5467:Ndst1	UTSW	18	60692021	missense	probably benign
R5830:Ndst1	UTSW	18	60703838	missense	probably damaging	1.00
R5968:Ndst1	UTSW	18	60713076	missense	probably benign
R6241:Ndst1	UTSW	18	60703829	missense	probably damaging	0.99
R6422:Ndst1	UTSW	18	60702953	missense	probably benign	0.44
R7099:Ndst1	UTSW	18	60695500	missense	possibly damaging	0.88
R7544:Ndst1	UTSW	18	60697184	missense	probably damaging	1.00
R8918:Ndst1	UTSW	18	60692011	missense	probably benign	0.00
R8951:Ndst1	UTSW	18	60697124	missense	probably benign
R9187:Ndst1	UTSW	18	60691196	missense	probably benign	0.03
R9374:Ndst1	UTSW	18	60712859	missense	probably damaging	0.97
R9526:Ndst1	UTSW	18	60705148	nonsense	probably null
R9552:Ndst1	UTSW	18	60712859	missense	probably damaging	0.97
R9651:Ndst1	UTSW	18	60700467	missense	probably damaging	0.96
V8831:Ndst1	UTSW	18	60702927	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGACTCACTGTGCCTTGTC -3'
(R):5'- TGAGGGAGCTAAGACTCCAGAC -3'

Sequencing Primer
(F):5'- CCTGTTTATAGGAATCTCAGCCGAG -3'
(R):5'- CCAGACGGGAAGGGGTTTTC -3'

Posted On

2015-04-17