Incidental Mutation 'R3953:Evc2'
ID308036
Institutional Source Beutler Lab
Gene Symbol Evc2
Ensembl Gene ENSMUSG00000050248
Gene NameEvC ciliary complex subunit 2
SynonymsLbn, limbin
MMRRC Submission 040830-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3953 (G1)
Quality Score158
Status Validated
Chromosome5
Chromosomal Location37338499-37425055 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 37380587 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000055130 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056365]
Predicted Effect probably null
Transcript: ENSMUST00000056365
SMART Domains Protein: ENSMUSP00000055130
Gene: ENSMUSG00000050248

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 40 59 N/A INTRINSIC
Pfam:EVC2_like 147 570 2.1e-191 PFAM
low complexity region 576 600 N/A INTRINSIC
coiled coil region 617 644 N/A INTRINSIC
low complexity region 780 791 N/A INTRINSIC
low complexity region 902 914 N/A INTRINSIC
coiled coil region 922 956 N/A INTRINSIC
low complexity region 1057 1071 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000101258
Meta Mutation Damage Score 0.9477 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions in bone formation and skeletal development. Mutations in this gene, as well as in a neighboring gene that lies in a head-to-head configuration, cause Ellis-van Creveld syndrome, an autosomal recessive skeletal dysplasia that is also known as chondroectodermal dysplasia. Mutations in this gene also cause acrofacial dysostosis Weyers type, also referred to as Curry-Hall syndrome, a disease that combines limb and facial abnormalities. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit perinatal lethality, short limbs and ribs, decreased osteoblast differentiation and abnormal chondrocyte physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam2 G A 14: 66,057,610 S262L probably damaging Het
Adgrf1 A G 17: 43,310,207 N445S probably benign Het
Aldh7a1 C A 18: 56,548,505 V198L probably damaging Het
Ank2 A T 3: 126,988,160 D6E probably damaging Het
Arhgap31 A G 16: 38,603,464 F747L probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Cadps T C 14: 12,505,937 D711G probably damaging Het
Clspn ACGGCGGCGGC A 4: 126,566,437 probably null Het
Cpsf3 A G 12: 21,313,805 D632G probably benign Het
Cyp4f18 C T 8: 72,000,957 R148H probably damaging Het
Dennd4a C A 9: 64,852,575 P321T probably damaging Het
Dennd5a A G 7: 109,905,699 M868T probably benign Het
Dnah2 G A 11: 69,454,103 T2715M probably damaging Het
Fam69b C T 2: 26,635,567 P171L probably benign Het
Fkbp8 T G 8: 70,534,867 S376A probably damaging Het
Gucy1a2 T C 9: 3,582,704 probably benign Het
Gys1 C T 7: 45,440,046 P274S probably damaging Het
Hbq1a T C 11: 32,300,214 probably null Het
Herc1 C T 9: 66,433,793 Q1731* probably null Het
Igfn1 A G 1: 135,967,180 Y1883H possibly damaging Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Lnx1 T C 5: 74,606,089 T455A probably benign Het
Mast2 A T 4: 116,313,729 H612Q probably damaging Het
Mcm9 G A 10: 53,563,344 H578Y probably damaging Het
Mefv A G 16: 3,715,400 S336P possibly damaging Het
Micu1 A T 10: 59,750,504 H134L probably benign Het
Mrgprb2 C T 7: 48,552,368 G203D possibly damaging Het
Ncapd2 T C 6: 125,170,734 I1179V probably damaging Het
Nek7 C A 1: 138,534,389 C79F probably damaging Het
Nup210l A T 3: 90,193,054 R1462S possibly damaging Het
Olfr1042 A G 2: 86,159,938 V144A probably benign Het
Olfr127 A T 17: 37,903,609 H21L probably benign Het
Olfr1475 G A 19: 13,479,442 S252L probably benign Het
Olfr566 A G 7: 102,856,617 C222R probably damaging Het
Pcnx3 A G 19: 5,683,780 probably benign Het
Pi4ka A G 16: 17,285,281 probably benign Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Ptprb A G 10: 116,341,494 N1320S probably benign Het
Ralgapa2 C T 2: 146,435,964 V426I probably damaging Het
Rhobtb2 T C 14: 69,794,039 T546A possibly damaging Het
Robo1 A G 16: 73,024,338 D1331G probably damaging Het
Sgcz A G 8: 37,526,192 probably benign Het
Slc26a1 T C 5: 108,673,582 D147G possibly damaging Het
Slc44a5 A G 3: 154,171,572 D13G probably benign Het
Slco1a1 A T 6: 141,923,107 M377K probably damaging Het
St18 T A 1: 6,802,893 L284Q probably damaging Het
Tbc1d9 C T 8: 83,233,532 T138I probably damaging Het
Tec T C 5: 72,782,177 probably null Het
Tln2 G A 9: 67,370,629 P368S probably damaging Het
Tmem131l C A 3: 83,910,419 C1257F probably damaging Het
Tmf1 C A 6: 97,176,206 R302L probably damaging Het
Tnip3 A T 6: 65,597,395 T137S possibly damaging Het
Trim30d C T 7: 104,472,521 G339D probably damaging Het
Tspan32 T A 7: 143,006,998 M61K probably damaging Het
Ttc6 T C 12: 57,697,452 V1290A probably benign Het
Ttn A G 2: 76,969,249 V429A possibly damaging Het
Vmn2r95 T A 17: 18,440,096 Y257N possibly damaging Het
Vps13d A G 4: 145,148,880 S1686P probably damaging Het
Wdr41 A G 13: 94,997,063 E75G probably damaging Het
Other mutations in Evc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00663:Evc2 APN 5 37421891 missense probably benign 0.26
IGL01294:Evc2 APN 5 37347510 critical splice donor site probably null
IGL01547:Evc2 APN 5 37393087 missense probably benign 0.09
IGL02233:Evc2 APN 5 37378337 missense probably damaging 0.99
IGL02253:Evc2 APN 5 37378427 splice site probably benign
IGL02993:Evc2 APN 5 37419157 missense probably benign 0.01
R0010:Evc2 UTSW 5 37417449 missense probably damaging 1.00
R0010:Evc2 UTSW 5 37417449 missense probably damaging 1.00
R0324:Evc2 UTSW 5 37393099 missense probably damaging 1.00
R0441:Evc2 UTSW 5 37417467 missense probably damaging 1.00
R0454:Evc2 UTSW 5 37417484 missense possibly damaging 0.78
R1291:Evc2 UTSW 5 37386815 missense probably damaging 1.00
R1433:Evc2 UTSW 5 37393083 missense probably damaging 1.00
R1485:Evc2 UTSW 5 37370556 missense probably benign 0.30
R1491:Evc2 UTSW 5 37393197 critical splice donor site probably null
R1502:Evc2 UTSW 5 37393096 missense probably benign
R1662:Evc2 UTSW 5 37348750 missense probably benign 0.00
R1891:Evc2 UTSW 5 37392079 missense probably damaging 1.00
R1965:Evc2 UTSW 5 37363532 missense possibly damaging 0.73
R1983:Evc2 UTSW 5 37415931 nonsense probably null
R2160:Evc2 UTSW 5 37380518 missense possibly damaging 0.87
R2237:Evc2 UTSW 5 37378183 missense probably benign 0.22
R3926:Evc2 UTSW 5 37383230 missense probably damaging 1.00
R3959:Evc2 UTSW 5 37415776 missense possibly damaging 0.63
R4281:Evc2 UTSW 5 37338594 missense probably benign 0.33
R4366:Evc2 UTSW 5 37338669 missense possibly damaging 0.93
R4707:Evc2 UTSW 5 37421860 missense probably benign 0.08
R4754:Evc2 UTSW 5 37387031 missense probably damaging 0.99
R5373:Evc2 UTSW 5 37378210 missense probably damaging 1.00
R5593:Evc2 UTSW 5 37386977 missense probably damaging 0.99
R5697:Evc2 UTSW 5 37370608 missense probably damaging 1.00
R5847:Evc2 UTSW 5 37404724 intron probably benign
R5874:Evc2 UTSW 5 37417539 intron probably benign
R6023:Evc2 UTSW 5 37348616 missense probably benign 0.13
R6285:Evc2 UTSW 5 37424579 missense possibly damaging 0.86
R6394:Evc2 UTSW 5 37378275 missense probably damaging 1.00
R6567:Evc2 UTSW 5 37419164 missense probably benign 0.17
R6669:Evc2 UTSW 5 37378378 missense possibly damaging 0.88
R7039:Evc2 UTSW 5 37421888 missense probably damaging 1.00
R7131:Evc2 UTSW 5 37410258 missense probably damaging 1.00
R7144:Evc2 UTSW 5 37386839 missense probably damaging 0.97
R7372:Evc2 UTSW 5 37387133 missense probably damaging 0.98
R7376:Evc2 UTSW 5 37370639 missense possibly damaging 0.57
R7607:Evc2 UTSW 5 37386856 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AGTGTAGAAGAGCTGATGGACTTC -3'
(R):5'- ATTCCATCACACGGTTGTCTTG -3'

Sequencing Primer
(F):5'- GGACTTCTTCCAGGCCAC -3'
(R):5'- ACACGGTTGTCTTGACTACCATG -3'
Posted On2015-04-17