Incidental Mutation 'R3953:Tmf1'
ID308041
Institutional Source Beutler Lab
Gene Symbol Tmf1
Ensembl Gene ENSMUSG00000030059
Gene NameTATA element modulatory factor 1
Synonyms7030402D04Rik, LOC232286
MMRRC Submission 040830-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.178) question?
Stock #R3953 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location97152997-97179122 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 97176206 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 302 (R302L)
Ref Sequence ENSEMBL: ENSMUSP00000093325 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095664] [ENSMUST00000124173]
Predicted Effect probably damaging
Transcript: ENSMUST00000095664
AA Change: R302L

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000093325
Gene: ENSMUSG00000030059
AA Change: R302L

DomainStartEndE-ValueType
low complexity region 111 122 N/A INTRINSIC
low complexity region 131 142 N/A INTRINSIC
low complexity region 194 211 N/A INTRINSIC
low complexity region 235 253 N/A INTRINSIC
low complexity region 261 276 N/A INTRINSIC
low complexity region 367 381 N/A INTRINSIC
low complexity region 410 426 N/A INTRINSIC
coiled coil region 443 536 N/A INTRINSIC
Pfam:TMF_DNA_bd 540 613 5e-24 PFAM
low complexity region 697 715 N/A INTRINSIC
low complexity region 719 732 N/A INTRINSIC
low complexity region 803 821 N/A INTRINSIC
coiled coil region 823 894 N/A INTRINSIC
low complexity region 923 937 N/A INTRINSIC
Pfam:TMF_TATA_bd 972 1085 1.5e-35 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000124173
AA Change: R302L

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000120093
Gene: ENSMUSG00000030059
AA Change: R302L

DomainStartEndE-ValueType
low complexity region 111 122 N/A INTRINSIC
low complexity region 131 142 N/A INTRINSIC
low complexity region 194 211 N/A INTRINSIC
low complexity region 235 253 N/A INTRINSIC
low complexity region 261 276 N/A INTRINSIC
low complexity region 367 381 N/A INTRINSIC
low complexity region 410 426 N/A INTRINSIC
coiled coil region 443 536 N/A INTRINSIC
Pfam:TMF_DNA_bd 540 613 1.4e-24 PFAM
low complexity region 697 715 N/A INTRINSIC
low complexity region 719 732 N/A INTRINSIC
Meta Mutation Damage Score 0.2122 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (61/61)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility associated with decreased testis weight, globozoospermia, absent acrosome, asthenozoospermia, and abnormal sperm midpiece morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam2 G A 14: 66,057,610 S262L probably damaging Het
Adgrf1 A G 17: 43,310,207 N445S probably benign Het
Aldh7a1 C A 18: 56,548,505 V198L probably damaging Het
Ank2 A T 3: 126,988,160 D6E probably damaging Het
Arhgap31 A G 16: 38,603,464 F747L probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Cadps T C 14: 12,505,937 D711G probably damaging Het
Clspn ACGGCGGCGGC A 4: 126,566,437 probably null Het
Cpsf3 A G 12: 21,313,805 D632G probably benign Het
Cyp4f18 C T 8: 72,000,957 R148H probably damaging Het
Dennd4a C A 9: 64,852,575 P321T probably damaging Het
Dennd5a A G 7: 109,905,699 M868T probably benign Het
Dnah2 G A 11: 69,454,103 T2715M probably damaging Het
Evc2 T C 5: 37,380,587 probably null Het
Fam69b C T 2: 26,635,567 P171L probably benign Het
Fkbp8 T G 8: 70,534,867 S376A probably damaging Het
Gucy1a2 T C 9: 3,582,704 probably benign Het
Gys1 C T 7: 45,440,046 P274S probably damaging Het
Hbq1a T C 11: 32,300,214 probably null Het
Herc1 C T 9: 66,433,793 Q1731* probably null Het
Igfn1 A G 1: 135,967,180 Y1883H possibly damaging Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Lnx1 T C 5: 74,606,089 T455A probably benign Het
Mast2 A T 4: 116,313,729 H612Q probably damaging Het
Mcm9 G A 10: 53,563,344 H578Y probably damaging Het
Mefv A G 16: 3,715,400 S336P possibly damaging Het
Micu1 A T 10: 59,750,504 H134L probably benign Het
Mrgprb2 C T 7: 48,552,368 G203D possibly damaging Het
Ncapd2 T C 6: 125,170,734 I1179V probably damaging Het
Nek7 C A 1: 138,534,389 C79F probably damaging Het
Nup210l A T 3: 90,193,054 R1462S possibly damaging Het
Olfr1042 A G 2: 86,159,938 V144A probably benign Het
Olfr127 A T 17: 37,903,609 H21L probably benign Het
Olfr1475 G A 19: 13,479,442 S252L probably benign Het
Olfr566 A G 7: 102,856,617 C222R probably damaging Het
Pcnx3 A G 19: 5,683,780 probably benign Het
Pi4ka A G 16: 17,285,281 probably benign Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Ptprb A G 10: 116,341,494 N1320S probably benign Het
Ralgapa2 C T 2: 146,435,964 V426I probably damaging Het
Rhobtb2 T C 14: 69,794,039 T546A possibly damaging Het
Robo1 A G 16: 73,024,338 D1331G probably damaging Het
Sgcz A G 8: 37,526,192 probably benign Het
Slc26a1 T C 5: 108,673,582 D147G possibly damaging Het
Slc44a5 A G 3: 154,171,572 D13G probably benign Het
Slco1a1 A T 6: 141,923,107 M377K probably damaging Het
St18 T A 1: 6,802,893 L284Q probably damaging Het
Tbc1d9 C T 8: 83,233,532 T138I probably damaging Het
Tec T C 5: 72,782,177 probably null Het
Tln2 G A 9: 67,370,629 P368S probably damaging Het
Tmem131l C A 3: 83,910,419 C1257F probably damaging Het
Tnip3 A T 6: 65,597,395 T137S possibly damaging Het
Trim30d C T 7: 104,472,521 G339D probably damaging Het
Tspan32 T A 7: 143,006,998 M61K probably damaging Het
Ttc6 T C 12: 57,697,452 V1290A probably benign Het
Ttn A G 2: 76,969,249 V429A possibly damaging Het
Vmn2r95 T A 17: 18,440,096 Y257N possibly damaging Het
Vps13d A G 4: 145,148,880 S1686P probably damaging Het
Wdr41 A G 13: 94,997,063 E75G probably damaging Het
Other mutations in Tmf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00661:Tmf1 APN 6 97176494 missense probably benign 0.00
IGL00846:Tmf1 APN 6 97173316 missense possibly damaging 0.88
IGL01575:Tmf1 APN 6 97175936 missense probably damaging 1.00
IGL01922:Tmf1 APN 6 97176930 missense probably benign 0.00
IGL02550:Tmf1 APN 6 97158561 missense probably benign 0.28
IGL02675:Tmf1 APN 6 97164042 splice site probably benign
IGL02985:Tmf1 APN 6 97176809 missense probably damaging 1.00
IGL03324:Tmf1 APN 6 97163653 missense probably damaging 0.99
caddy UTSW 6 97161447 nonsense probably null
R0028:Tmf1 UTSW 6 97158098 missense probably damaging 1.00
R0153:Tmf1 UTSW 6 97170384 missense probably damaging 0.97
R0325:Tmf1 UTSW 6 97176504 missense possibly damaging 0.51
R0420:Tmf1 UTSW 6 97176141 missense probably damaging 1.00
R0730:Tmf1 UTSW 6 97176492 missense probably benign
R0825:Tmf1 UTSW 6 97175995 missense probably benign
R0827:Tmf1 UTSW 6 97158050 nonsense probably null
R0839:Tmf1 UTSW 6 97176323 missense probably damaging 1.00
R1078:Tmf1 UTSW 6 97173300 missense probably damaging 1.00
R1905:Tmf1 UTSW 6 97161479 missense possibly damaging 0.53
R2274:Tmf1 UTSW 6 97163586 missense probably damaging 1.00
R3701:Tmf1 UTSW 6 97172331 missense possibly damaging 0.51
R3955:Tmf1 UTSW 6 97176206 missense probably damaging 0.99
R4398:Tmf1 UTSW 6 97178896 missense probably damaging 0.99
R4416:Tmf1 UTSW 6 97178988 missense probably damaging 1.00
R4497:Tmf1 UTSW 6 97172332 missense probably benign 0.00
R4592:Tmf1 UTSW 6 97173400 missense probably benign 0.00
R4669:Tmf1 UTSW 6 97170427 missense probably benign 0.00
R5214:Tmf1 UTSW 6 97167292 missense possibly damaging 0.81
R5352:Tmf1 UTSW 6 97176809 missense probably damaging 1.00
R5530:Tmf1 UTSW 6 97158087 missense probably damaging 1.00
R5815:Tmf1 UTSW 6 97173403 missense probably benign 0.28
R6806:Tmf1 UTSW 6 97161447 nonsense probably null
R6837:Tmf1 UTSW 6 97176581 missense possibly damaging 0.76
R6853:Tmf1 UTSW 6 97168849 missense probably damaging 0.99
R6887:Tmf1 UTSW 6 97176838 missense probably damaging 1.00
R7058:Tmf1 UTSW 6 97156950 missense probably damaging 1.00
R7145:Tmf1 UTSW 6 97176118 missense probably damaging 1.00
R7340:Tmf1 UTSW 6 97168100 missense possibly damaging 0.81
R7573:Tmf1 UTSW 6 97158494 missense probably benign 0.14
R7809:Tmf1 UTSW 6 97161459 missense probably damaging 0.99
R7833:Tmf1 UTSW 6 97161411 missense probably benign 0.06
R7916:Tmf1 UTSW 6 97161411 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TTTGGGGTTGAAGGACTCAC -3'
(R):5'- CGAAGGATATGGCTTTGGAACC -3'

Sequencing Primer
(F):5'- GTTGAAGGACTCACTATTATGGGTAC -3'
(R):5'- GATATGGCTTTGGAACCTAAAGAAC -3'
Posted On2015-04-17