Incidental Mutation 'R3953:Mrgprb2'
ID308047
Institutional Source Beutler Lab
Gene Symbol Mrgprb2
Ensembl Gene ENSMUSG00000050425
Gene NameMAS-related GPR, member B2
Synonyms4833406I20Rik
MMRRC Submission 040830-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3953 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location48550965-48558086 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 48552368 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 203 (G203D)
Ref Sequence ENSEMBL: ENSMUSP00000061878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052730]
Predicted Effect possibly damaging
Transcript: ENSMUST00000052730
AA Change: G203D

PolyPhen 2 Score 0.784 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000061878
Gene: ENSMUSG00000050425
AA Change: G203D

DomainStartEndE-ValueType
Pfam:7tm_1 54 286 2.1e-7 PFAM
low complexity region 293 308 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (61/61)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired mast cell activation and inflammatory response after 48/80 treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam2 G A 14: 66,057,610 S262L probably damaging Het
Adgrf1 A G 17: 43,310,207 N445S probably benign Het
Aldh7a1 C A 18: 56,548,505 V198L probably damaging Het
Ank2 A T 3: 126,988,160 D6E probably damaging Het
Arhgap31 A G 16: 38,603,464 F747L probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Cadps T C 14: 12,505,937 D711G probably damaging Het
Clspn ACGGCGGCGGC A 4: 126,566,437 probably null Het
Cpsf3 A G 12: 21,313,805 D632G probably benign Het
Cyp4f18 C T 8: 72,000,957 R148H probably damaging Het
Dennd4a C A 9: 64,852,575 P321T probably damaging Het
Dennd5a A G 7: 109,905,699 M868T probably benign Het
Dnah2 G A 11: 69,454,103 T2715M probably damaging Het
Evc2 T C 5: 37,380,587 probably null Het
Fam69b C T 2: 26,635,567 P171L probably benign Het
Fkbp8 T G 8: 70,534,867 S376A probably damaging Het
Gucy1a2 T C 9: 3,582,704 probably benign Het
Gys1 C T 7: 45,440,046 P274S probably damaging Het
Hbq1a T C 11: 32,300,214 probably null Het
Herc1 C T 9: 66,433,793 Q1731* probably null Het
Igfn1 A G 1: 135,967,180 Y1883H possibly damaging Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Lnx1 T C 5: 74,606,089 T455A probably benign Het
Mast2 A T 4: 116,313,729 H612Q probably damaging Het
Mcm9 G A 10: 53,563,344 H578Y probably damaging Het
Mefv A G 16: 3,715,400 S336P possibly damaging Het
Micu1 A T 10: 59,750,504 H134L probably benign Het
Ncapd2 T C 6: 125,170,734 I1179V probably damaging Het
Nek7 C A 1: 138,534,389 C79F probably damaging Het
Nup210l A T 3: 90,193,054 R1462S possibly damaging Het
Olfr1042 A G 2: 86,159,938 V144A probably benign Het
Olfr127 A T 17: 37,903,609 H21L probably benign Het
Olfr1475 G A 19: 13,479,442 S252L probably benign Het
Olfr566 A G 7: 102,856,617 C222R probably damaging Het
Pcnx3 A G 19: 5,683,780 probably benign Het
Pi4ka A G 16: 17,285,281 probably benign Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Ptprb A G 10: 116,341,494 N1320S probably benign Het
Ralgapa2 C T 2: 146,435,964 V426I probably damaging Het
Rhobtb2 T C 14: 69,794,039 T546A possibly damaging Het
Robo1 A G 16: 73,024,338 D1331G probably damaging Het
Sgcz A G 8: 37,526,192 probably benign Het
Slc26a1 T C 5: 108,673,582 D147G possibly damaging Het
Slc44a5 A G 3: 154,171,572 D13G probably benign Het
Slco1a1 A T 6: 141,923,107 M377K probably damaging Het
St18 T A 1: 6,802,893 L284Q probably damaging Het
Tbc1d9 C T 8: 83,233,532 T138I probably damaging Het
Tec T C 5: 72,782,177 probably null Het
Tln2 G A 9: 67,370,629 P368S probably damaging Het
Tmem131l C A 3: 83,910,419 C1257F probably damaging Het
Tmf1 C A 6: 97,176,206 R302L probably damaging Het
Tnip3 A T 6: 65,597,395 T137S possibly damaging Het
Trim30d C T 7: 104,472,521 G339D probably damaging Het
Tspan32 T A 7: 143,006,998 M61K probably damaging Het
Ttc6 T C 12: 57,697,452 V1290A probably benign Het
Ttn A G 2: 76,969,249 V429A possibly damaging Het
Vmn2r95 T A 17: 18,440,096 Y257N possibly damaging Het
Vps13d A G 4: 145,148,880 S1686P probably damaging Het
Wdr41 A G 13: 94,997,063 E75G probably damaging Het
Other mutations in Mrgprb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01311:Mrgprb2 APN 7 48551998 missense probably benign 0.29
IGL01509:Mrgprb2 APN 7 48552926 missense possibly damaging 0.70
IGL01978:Mrgprb2 APN 7 48552564 missense probably damaging 0.98
IGL02307:Mrgprb2 APN 7 48552896 missense probably benign 0.01
IGL02726:Mrgprb2 APN 7 48552870 missense probably damaging 0.97
IGL03393:Mrgprb2 APN 7 48552902 missense probably benign 0.13
R0190:Mrgprb2 UTSW 7 48552777 missense possibly damaging 0.95
R0334:Mrgprb2 UTSW 7 48552329 missense probably damaging 1.00
R0514:Mrgprb2 UTSW 7 48551970 missense probably benign 0.05
R2177:Mrgprb2 UTSW 7 48552380 missense probably benign 0.11
R2932:Mrgprb2 UTSW 7 48552446 missense probably benign 0.17
R3417:Mrgprb2 UTSW 7 48552533 missense probably damaging 0.98
R5673:Mrgprb2 UTSW 7 48552373 missense probably benign 0.00
R5733:Mrgprb2 UTSW 7 48552513 missense probably benign 0.01
R5890:Mrgprb2 UTSW 7 48551959 makesense probably null
R5915:Mrgprb2 UTSW 7 48552806 missense probably benign 0.14
R6147:Mrgprb2 UTSW 7 48552365 missense possibly damaging 0.64
R6381:Mrgprb2 UTSW 7 48552390 missense probably benign 0.01
R6414:Mrgprb2 UTSW 7 48552381 missense probably benign 0.01
R6965:Mrgprb2 UTSW 7 48552849 missense probably damaging 0.97
R7017:Mrgprb2 UTSW 7 48552837 missense probably benign 0.08
R7341:Mrgprb2 UTSW 7 48552896 missense probably benign 0.01
R7399:Mrgprb2 UTSW 7 48552142 missense probably damaging 1.00
Z1177:Mrgprb2 UTSW 7 48552973 start codon destroyed probably null
Predicted Primers PCR Primer
(F):5'- GGGGTTCATACAGCTGTTAACAC -3'
(R):5'- TCGCTGTAAACGTCCAAGAC -3'

Sequencing Primer
(F):5'- ACACAGGATAGGAATAGTATCTCAAG -3'
(R):5'- CACACATCAGCTATCACATGTTTTG -3'
Posted On2015-04-17