Incidental Mutation 'R3953:Dennd4a'
ID 308057
Institutional Source Beutler Lab
Gene Symbol Dennd4a
Ensembl Gene ENSMUSG00000053641
Gene Name DENN domain containing 4A
Synonyms F730015K02Rik
MMRRC Submission 040830-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.489) question?
Stock # R3953 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 64718622-64826949 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 64759857 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Threonine at position 321 (P321T)
Ref Sequence ENSEMBL: ENSMUSP00000037915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038890]
AlphaFold E9Q8V6
Predicted Effect probably damaging
Transcript: ENSMUST00000038890
AA Change: P321T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037915
Gene: ENSMUSG00000053641
AA Change: P321T

DomainStartEndE-ValueType
internal_repeat_1 45 93 3.26e-5 PROSPERO
uDENN 169 276 1.71e-28 SMART
DENN 309 493 2.4e-73 SMART
dDENN 559 633 4.15e-27 SMART
low complexity region 724 735 N/A INTRINSIC
low complexity region 936 950 N/A INTRINSIC
low complexity region 1176 1191 N/A INTRINSIC
low complexity region 1249 1262 N/A INTRINSIC
low complexity region 1402 1417 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215025
Meta Mutation Damage Score 0.8643 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DENN domain-containing protein that may function as a guanine nucleotide exchange factor that specifically activates ras-related protein Rab-10. This protein also contains a interferon stimulated response element-binding domain and may be involved in regulating the v-myc avian myelocytomatosis viral (MYC) oncogene. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 8. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam2 G A 14: 66,295,059 (GRCm39) S262L probably damaging Het
Adgrf1 A G 17: 43,621,098 (GRCm39) N445S probably benign Het
Aldh7a1 C A 18: 56,681,577 (GRCm39) V198L probably damaging Het
Ank2 A T 3: 126,781,809 (GRCm39) D6E probably damaging Het
Arhgap31 A G 16: 38,423,826 (GRCm39) F747L probably benign Het
B4galt3 C A 1: 171,101,613 (GRCm39) H196N probably damaging Het
Cadps T C 14: 12,505,937 (GRCm38) D711G probably damaging Het
Clspn ACGGCGGCGGC A 4: 126,460,230 (GRCm39) probably null Het
Cpsf3 A G 12: 21,363,806 (GRCm39) D632G probably benign Het
Cyp4f18 C T 8: 72,754,801 (GRCm39) R148H probably damaging Het
Dennd5a A G 7: 109,504,906 (GRCm39) M868T probably benign Het
Dipk1b C T 2: 26,525,579 (GRCm39) P171L probably benign Het
Dnah2 G A 11: 69,344,929 (GRCm39) T2715M probably damaging Het
Evc2 T C 5: 37,537,931 (GRCm39) probably null Het
Fkbp8 T G 8: 70,987,517 (GRCm39) S376A probably damaging Het
Gucy1a2 T C 9: 3,582,704 (GRCm39) probably benign Het
Gys1 C T 7: 45,089,470 (GRCm39) P274S probably damaging Het
Hbq1a T C 11: 32,250,214 (GRCm39) probably null Het
Herc1 C T 9: 66,341,075 (GRCm39) Q1731* probably null Het
Igfn1 A G 1: 135,894,918 (GRCm39) Y1883H possibly damaging Het
Lmf1 G A 17: 25,873,445 (GRCm39) V317M probably damaging Het
Lnx1 T C 5: 74,766,750 (GRCm39) T455A probably benign Het
Mast2 A T 4: 116,170,926 (GRCm39) H612Q probably damaging Het
Mcm9 G A 10: 53,439,440 (GRCm39) H578Y probably damaging Het
Mefv A G 16: 3,533,264 (GRCm39) S336P possibly damaging Het
Micu1 A T 10: 59,586,326 (GRCm39) H134L probably benign Het
Mrgprb2 C T 7: 48,202,116 (GRCm39) G203D possibly damaging Het
Ncapd2 T C 6: 125,147,697 (GRCm39) I1179V probably damaging Het
Nek7 C A 1: 138,462,127 (GRCm39) C79F probably damaging Het
Nup210l A T 3: 90,100,361 (GRCm39) R1462S possibly damaging Het
Or14j6 A T 17: 38,214,500 (GRCm39) H21L probably benign Het
Or51f1 A G 7: 102,505,824 (GRCm39) C222R probably damaging Het
Or5al1 A G 2: 85,990,282 (GRCm39) V144A probably benign Het
Or5b119 G A 19: 13,456,806 (GRCm39) S252L probably benign Het
Pcnx3 A G 19: 5,733,808 (GRCm39) probably benign Het
Pi4ka A G 16: 17,103,145 (GRCm39) probably benign Het
Ptgir A G 7: 16,640,794 (GRCm39) M29V possibly damaging Het
Ptprb A G 10: 116,177,399 (GRCm39) N1320S probably benign Het
Ralgapa2 C T 2: 146,277,884 (GRCm39) V426I probably damaging Het
Rhobtb2 T C 14: 70,031,488 (GRCm39) T546A possibly damaging Het
Robo1 A G 16: 72,821,226 (GRCm39) D1331G probably damaging Het
Sgcz A G 8: 37,993,346 (GRCm39) probably benign Het
Slc26a1 T C 5: 108,821,448 (GRCm39) D147G possibly damaging Het
Slc44a5 A G 3: 153,877,209 (GRCm39) D13G probably benign Het
Slco1a1 A T 6: 141,868,833 (GRCm39) M377K probably damaging Het
St18 T A 1: 6,873,117 (GRCm39) L284Q probably damaging Het
Tbc1d9 C T 8: 83,960,161 (GRCm39) T138I probably damaging Het
Tec T C 5: 72,939,520 (GRCm39) probably null Het
Tln2 G A 9: 67,277,911 (GRCm39) P368S probably damaging Het
Tmem131l C A 3: 83,817,726 (GRCm39) C1257F probably damaging Het
Tmf1 C A 6: 97,153,167 (GRCm39) R302L probably damaging Het
Tnip3 A T 6: 65,574,379 (GRCm39) T137S possibly damaging Het
Trim30d C T 7: 104,121,728 (GRCm39) G339D probably damaging Het
Tspan32 T A 7: 142,560,735 (GRCm39) M61K probably damaging Het
Ttc6 T C 12: 57,744,238 (GRCm39) V1290A probably benign Het
Ttn A G 2: 76,799,593 (GRCm39) V429A possibly damaging Het
Vmn2r95 T A 17: 18,660,358 (GRCm39) Y257N possibly damaging Het
Vps13d A G 4: 144,875,450 (GRCm39) S1686P probably damaging Het
Wdr41 A G 13: 95,133,571 (GRCm39) E75G probably damaging Het
Other mutations in Dennd4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Dennd4a APN 9 64,819,044 (GRCm39) missense probably damaging 1.00
IGL01610:Dennd4a APN 9 64,814,166 (GRCm39) missense probably damaging 0.99
IGL01788:Dennd4a APN 9 64,749,903 (GRCm39) missense probably benign 0.00
IGL01827:Dennd4a APN 9 64,749,843 (GRCm39) nonsense probably null
IGL01828:Dennd4a APN 9 64,749,843 (GRCm39) nonsense probably null
IGL01829:Dennd4a APN 9 64,749,843 (GRCm39) nonsense probably null
IGL01979:Dennd4a APN 9 64,801,691 (GRCm39) missense probably benign 0.00
IGL02100:Dennd4a APN 9 64,816,988 (GRCm39) splice site probably benign
IGL02339:Dennd4a APN 9 64,749,843 (GRCm39) nonsense probably null
IGL02341:Dennd4a APN 9 64,749,843 (GRCm39) nonsense probably null
IGL02584:Dennd4a APN 9 64,758,580 (GRCm39) missense probably damaging 1.00
IGL02607:Dennd4a APN 9 64,769,609 (GRCm39) missense probably damaging 0.99
IGL02654:Dennd4a APN 9 64,817,473 (GRCm39) splice site probably benign
IGL02701:Dennd4a APN 9 64,804,635 (GRCm39) missense possibly damaging 0.50
IGL03051:Dennd4a APN 9 64,769,696 (GRCm39) missense probably damaging 1.00
IGL03257:Dennd4a APN 9 64,779,156 (GRCm39) missense possibly damaging 0.93
IGL03346:Dennd4a APN 9 64,795,808 (GRCm39) missense possibly damaging 0.47
IGL03349:Dennd4a APN 9 64,796,256 (GRCm39) missense probably damaging 1.00
IGL03398:Dennd4a APN 9 64,779,164 (GRCm39) missense probably benign 0.32
R0010:Dennd4a UTSW 9 64,803,997 (GRCm39) missense probably benign 0.00
R0010:Dennd4a UTSW 9 64,803,997 (GRCm39) missense probably benign 0.00
R0129:Dennd4a UTSW 9 64,800,576 (GRCm39) missense probably damaging 1.00
R0220:Dennd4a UTSW 9 64,759,727 (GRCm39) missense probably damaging 1.00
R0396:Dennd4a UTSW 9 64,769,673 (GRCm39) missense probably damaging 1.00
R0881:Dennd4a UTSW 9 64,758,665 (GRCm39) critical splice donor site probably null
R1225:Dennd4a UTSW 9 64,818,957 (GRCm39) missense probably benign 0.03
R1311:Dennd4a UTSW 9 64,817,286 (GRCm39) missense probably benign 0.34
R1448:Dennd4a UTSW 9 64,813,327 (GRCm39) missense possibly damaging 0.95
R1450:Dennd4a UTSW 9 64,818,947 (GRCm39) missense probably benign 0.03
R1630:Dennd4a UTSW 9 64,779,164 (GRCm39) missense probably benign 0.32
R1709:Dennd4a UTSW 9 64,796,887 (GRCm39) missense possibly damaging 0.92
R1824:Dennd4a UTSW 9 64,766,640 (GRCm39) critical splice donor site probably null
R1851:Dennd4a UTSW 9 64,769,312 (GRCm39) missense probably damaging 1.00
R1870:Dennd4a UTSW 9 64,804,516 (GRCm39) missense probably benign 0.00
R1900:Dennd4a UTSW 9 64,804,618 (GRCm39) missense probably damaging 0.99
R1911:Dennd4a UTSW 9 64,796,368 (GRCm39) missense probably damaging 1.00
R1938:Dennd4a UTSW 9 64,749,772 (GRCm39) missense probably damaging 1.00
R1954:Dennd4a UTSW 9 64,759,749 (GRCm39) missense probably benign 0.02
R1955:Dennd4a UTSW 9 64,759,749 (GRCm39) missense probably benign 0.02
R2049:Dennd4a UTSW 9 64,796,887 (GRCm39) missense possibly damaging 0.92
R2129:Dennd4a UTSW 9 64,813,256 (GRCm39) splice site probably null
R2138:Dennd4a UTSW 9 64,796,619 (GRCm39) missense probably damaging 1.00
R2929:Dennd4a UTSW 9 64,759,699 (GRCm39) missense possibly damaging 0.85
R3083:Dennd4a UTSW 9 64,813,363 (GRCm39) missense probably benign 0.03
R3108:Dennd4a UTSW 9 64,819,669 (GRCm39) missense probably benign 0.23
R3176:Dennd4a UTSW 9 64,796,275 (GRCm39) missense probably damaging 1.00
R3177:Dennd4a UTSW 9 64,796,275 (GRCm39) missense probably damaging 1.00
R3276:Dennd4a UTSW 9 64,796,275 (GRCm39) missense probably damaging 1.00
R3277:Dennd4a UTSW 9 64,796,275 (GRCm39) missense probably damaging 1.00
R3890:Dennd4a UTSW 9 64,779,310 (GRCm39) missense probably damaging 1.00
R3963:Dennd4a UTSW 9 64,769,613 (GRCm39) missense probably damaging 1.00
R4059:Dennd4a UTSW 9 64,819,174 (GRCm39) missense possibly damaging 0.92
R4499:Dennd4a UTSW 9 64,817,405 (GRCm39) missense possibly damaging 0.78
R4500:Dennd4a UTSW 9 64,817,405 (GRCm39) missense possibly damaging 0.78
R4501:Dennd4a UTSW 9 64,817,405 (GRCm39) missense possibly damaging 0.78
R4671:Dennd4a UTSW 9 64,801,689 (GRCm39) missense probably benign
R4701:Dennd4a UTSW 9 64,804,639 (GRCm39) missense possibly damaging 0.91
R4821:Dennd4a UTSW 9 64,804,531 (GRCm39) missense possibly damaging 0.92
R4829:Dennd4a UTSW 9 64,796,338 (GRCm39) missense probably damaging 1.00
R4876:Dennd4a UTSW 9 64,803,872 (GRCm39) missense probably benign
R4881:Dennd4a UTSW 9 64,746,126 (GRCm39) missense possibly damaging 0.77
R4962:Dennd4a UTSW 9 64,813,285 (GRCm39) missense probably benign 0.00
R5225:Dennd4a UTSW 9 64,796,210 (GRCm39) missense possibly damaging 0.94
R5557:Dennd4a UTSW 9 64,811,509 (GRCm39) missense probably benign 0.07
R5649:Dennd4a UTSW 9 64,758,491 (GRCm39) splice site probably null
R5868:Dennd4a UTSW 9 64,804,011 (GRCm39) missense probably benign 0.02
R5876:Dennd4a UTSW 9 64,819,037 (GRCm39) missense probably damaging 1.00
R6052:Dennd4a UTSW 9 64,794,227 (GRCm39) missense probably damaging 1.00
R6411:Dennd4a UTSW 9 64,779,181 (GRCm39) missense probably benign 0.04
R6596:Dennd4a UTSW 9 64,759,702 (GRCm39) missense probably damaging 1.00
R6668:Dennd4a UTSW 9 64,794,247 (GRCm39) missense probably damaging 1.00
R6915:Dennd4a UTSW 9 64,759,771 (GRCm39) nonsense probably null
R7056:Dennd4a UTSW 9 64,814,205 (GRCm39) missense possibly damaging 0.89
R7107:Dennd4a UTSW 9 64,801,681 (GRCm39) missense possibly damaging 0.79
R7203:Dennd4a UTSW 9 64,803,756 (GRCm39) missense probably benign 0.05
R7238:Dennd4a UTSW 9 64,769,238 (GRCm39) missense probably damaging 1.00
R7373:Dennd4a UTSW 9 64,804,551 (GRCm39) missense probably benign 0.01
R7454:Dennd4a UTSW 9 64,759,852 (GRCm39) missense probably damaging 1.00
R7546:Dennd4a UTSW 9 64,780,326 (GRCm39) missense probably damaging 1.00
R7590:Dennd4a UTSW 9 64,795,869 (GRCm39) missense probably benign 0.01
R7662:Dennd4a UTSW 9 64,759,713 (GRCm39) missense probably damaging 1.00
R7782:Dennd4a UTSW 9 64,814,202 (GRCm39) missense probably damaging 0.98
R7909:Dennd4a UTSW 9 64,780,275 (GRCm39) critical splice acceptor site probably null
R7976:Dennd4a UTSW 9 64,759,794 (GRCm39) missense possibly damaging 0.95
R8026:Dennd4a UTSW 9 64,780,312 (GRCm39) missense probably damaging 1.00
R8034:Dennd4a UTSW 9 64,795,850 (GRCm39) missense probably benign 0.01
R8089:Dennd4a UTSW 9 64,756,457 (GRCm39) missense probably damaging 1.00
R8298:Dennd4a UTSW 9 64,814,157 (GRCm39) missense probably benign 0.00
R8397:Dennd4a UTSW 9 64,796,391 (GRCm39) missense probably benign
R8425:Dennd4a UTSW 9 64,746,256 (GRCm39) missense probably damaging 1.00
R8495:Dennd4a UTSW 9 64,794,161 (GRCm39) missense probably damaging 1.00
R8855:Dennd4a UTSW 9 64,819,672 (GRCm39) missense probably benign
R9219:Dennd4a UTSW 9 64,796,376 (GRCm39) missense probably damaging 0.96
R9275:Dennd4a UTSW 9 64,749,906 (GRCm39) missense probably damaging 1.00
R9376:Dennd4a UTSW 9 64,819,974 (GRCm39) missense probably benign 0.00
R9485:Dennd4a UTSW 9 64,814,388 (GRCm39) nonsense probably null
R9672:Dennd4a UTSW 9 64,800,640 (GRCm39) missense probably benign
R9746:Dennd4a UTSW 9 64,801,793 (GRCm39) missense probably benign
X0026:Dennd4a UTSW 9 64,804,602 (GRCm39) missense possibly damaging 0.67
Z1088:Dennd4a UTSW 9 64,779,304 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGCTAAATACTCAGCTGATCATC -3'
(R):5'- CATCTTGGATTGTCAATGCTTTCTG -3'

Sequencing Primer
(F):5'- ATACTCAGCTGATCATCTGTTTTG -3'
(R):5'- TGGAACTCACTCTGTAGACCAGG -3'
Posted On 2015-04-17