Incidental Mutation 'R0377:Pnpla6'
ID30806
Institutional Source Beutler Lab
Gene Symbol Pnpla6
Ensembl Gene ENSMUSG00000004565
Gene Namepatatin-like phospholipase domain containing 6
SynonymsNte, Swiss-cheese, MSws
MMRRC Submission 038583-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0377 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location3515384-3544267 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3541501 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1165 (E1165G)
Ref Sequence ENSEMBL: ENSMUSP00000106699 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004681] [ENSMUST00000111070] [ENSMUST00000207421] [ENSMUST00000207941] [ENSMUST00000208002]
Predicted Effect probably damaging
Transcript: ENSMUST00000004681
AA Change: E1165G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000004681
Gene: ENSMUSG00000004565
AA Change: E1165G

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
low complexity region 67 83 N/A INTRINSIC
low complexity region 87 101 N/A INTRINSIC
cNMP 147 272 3.17e-13 SMART
cNMP 465 584 3.17e-4 SMART
cNMP 587 703 3.45e-5 SMART
Blast:cNMP 742 777 7e-11 BLAST
Pfam:Patatin 933 1099 5e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111070
AA Change: E1165G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000106699
Gene: ENSMUSG00000004565
AA Change: E1165G

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
low complexity region 67 83 N/A INTRINSIC
low complexity region 87 101 N/A INTRINSIC
cNMP 147 272 3.17e-13 SMART
cNMP 465 584 3.17e-4 SMART
cNMP 587 703 3.45e-5 SMART
Blast:cNMP 742 777 7e-11 BLAST
Pfam:Patatin 933 1099 1.4e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207299
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207317
Predicted Effect unknown
Transcript: ENSMUST00000207336
AA Change: E87G
Predicted Effect probably benign
Transcript: ENSMUST00000207421
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207929
Predicted Effect probably damaging
Transcript: ENSMUST00000207941
AA Change: E1154G

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect possibly damaging
Transcript: ENSMUST00000208002
AA Change: E1183G

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208370
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208691
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208851
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208914
Meta Mutation Damage Score 0.2993 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.8%
Validation Efficiency 97% (67/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phospholipase that deacetylates intracellular phosphatidylcholine to produce glycerophosphocholine. It is thought to function in neurite outgrowth and process elongation during neuronal differentiation. The protein is anchored to the cytoplasmic face of the endoplasmic reticulum in both neurons and non-neuronal cells. Mutations in this gene result in autosomal recessive spastic paraplegia, and the protein is the target for neurodegeneration induced by organophosphorus compounds and chemical warfare agents. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality during early gestation. Conditional inactivation in the central nervous system leads to neurodegeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 C A 11: 94,375,096 V107F possibly damaging Het
Acad11 T A 9: 104,081,692 probably benign Het
Ache G A 5: 137,290,928 E299K possibly damaging Het
Adam5 T C 8: 24,747,541 T618A probably benign Het
Amigo2 T A 15: 97,246,380 T54S possibly damaging Het
Anapc1 A G 2: 128,641,340 probably null Het
Armc4 G A 18: 7,127,415 R933C probably benign Het
Btaf1 A G 19: 36,989,002 K1057E probably benign Het
Cep55 T A 19: 38,071,889 L396* probably null Het
Cic C A 7: 25,285,799 H1157N probably damaging Het
Cntnap5a A T 1: 116,292,529 T690S probably benign Het
D5Ertd579e A T 5: 36,604,567 C1319S probably benign Het
Dnah6 A G 6: 73,121,992 S2027P possibly damaging Het
Dntt G A 19: 41,047,627 W369* probably null Het
Esp18 T A 17: 39,409,944 W27R probably benign Het
Fam227b A T 2: 126,125,000 probably benign Het
Fbxo31 G A 8: 121,559,102 probably benign Het
Gm13547 G A 2: 29,761,791 probably null Het
Gnl2 T A 4: 125,046,382 probably benign Het
Gpx2 G A 12: 76,795,156 Q74* probably null Het
Gucy2c A G 6: 136,750,917 probably null Het
Hoxa5 A T 6: 52,202,646 W250R probably damaging Het
Izumo4 G A 10: 80,702,840 R42H probably damaging Het
Kcnj12 G A 11: 61,069,396 M71I probably benign Het
Kmt2b A T 7: 30,574,193 L2333Q probably damaging Het
Mak T C 13: 41,049,348 E177G probably damaging Het
Map3k7 T A 4: 31,985,731 I218N probably damaging Het
Mark3 T C 12: 111,629,029 L393P probably damaging Het
Msh4 A G 3: 153,896,890 S234P probably benign Het
Mug1 A G 6: 121,857,361 D367G probably benign Het
Mypn A G 10: 63,127,622 probably benign Het
Ncapg T C 5: 45,693,817 V784A probably benign Het
Nutf2 T A 8: 105,878,872 V113D probably damaging Het
Olfr1080 A T 2: 86,553,583 D180E probably damaging Het
Opn3 T C 1: 175,663,694 M258V probably damaging Het
Osbpl7 A G 11: 97,055,934 D211G probably damaging Het
Pcnx C T 12: 81,974,579 probably benign Het
Plekhd1 G A 12: 80,706,436 probably benign Het
Prkab2 T A 3: 97,662,317 D66E probably benign Het
Prpsap2 A G 11: 61,741,000 I177T possibly damaging Het
Ptpn23 A T 9: 110,388,132 S885R possibly damaging Het
Rab26 A T 17: 24,530,045 probably benign Het
Rab5a G A 17: 53,500,462 M175I probably benign Het
Rassf9 T A 10: 102,545,649 D297E probably benign Het
Rimbp2 C T 5: 128,803,861 R161Q probably damaging Het
Rtp1 A G 16: 23,431,284 Y133C probably damaging Het
Sdr16c5 G A 4: 4,005,546 L263F probably benign Het
Sec14l1 T G 11: 117,149,140 probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spaca1 T C 4: 34,044,267 probably null Het
Stk36 C T 1: 74,612,730 P394L probably benign Het
Stk4 T C 2: 164,096,800 I196T probably damaging Het
Sult1b1 A T 5: 87,517,376 M233K probably damaging Het
Tmem8b C T 4: 43,674,005 T212M probably damaging Het
Tmprss11g A T 5: 86,490,751 F293I probably damaging Het
Tnfsf11 T G 14: 78,299,912 T104P probably benign Het
Trmt2a G A 16: 18,249,703 R80Q possibly damaging Het
Trps1 C A 15: 50,831,778 E324* probably null Het
U2surp C T 9: 95,484,443 V470I probably benign Het
Wdr18 G A 10: 79,967,502 R400H probably benign Het
Wdr78 A G 4: 103,048,259 V775A probably damaging Het
Zfp119b T A 17: 55,938,671 H505L probably damaging Het
Zfp619 T A 7: 39,536,797 C750* probably null Het
Zfr T C 15: 12,160,591 I750T probably benign Het
Other mutations in Pnpla6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Pnpla6 APN 8 3523808 missense probably damaging 1.00
IGL00820:Pnpla6 APN 8 3532358 missense possibly damaging 0.95
IGL00839:Pnpla6 APN 8 3542299 missense probably benign 0.05
IGL01732:Pnpla6 APN 8 3522616 missense probably damaging 0.99
IGL01973:Pnpla6 APN 8 3517619 missense probably damaging 1.00
IGL02267:Pnpla6 APN 8 3517327 missense probably benign 0.00
IGL03246:Pnpla6 APN 8 3531530 missense probably benign 0.01
IGL03286:Pnpla6 APN 8 3531473 missense probably damaging 0.99
I0000:Pnpla6 UTSW 8 3542322 missense probably benign
R0141:Pnpla6 UTSW 8 3532117 critical splice donor site probably null
R0180:Pnpla6 UTSW 8 3524250 critical splice acceptor site probably null
R0563:Pnpla6 UTSW 8 3523333 missense possibly damaging 0.51
R0660:Pnpla6 UTSW 8 3522269 unclassified probably benign
R0786:Pnpla6 UTSW 8 3523317 missense probably benign
R0827:Pnpla6 UTSW 8 3517618 missense possibly damaging 0.71
R0882:Pnpla6 UTSW 8 3517081 missense probably damaging 1.00
R1512:Pnpla6 UTSW 8 3535459 splice site probably benign
R1552:Pnpla6 UTSW 8 3522403 missense probably damaging 1.00
R1609:Pnpla6 UTSW 8 3517135 missense probably damaging 1.00
R1770:Pnpla6 UTSW 8 3534634 missense possibly damaging 0.94
R1779:Pnpla6 UTSW 8 3541404 missense probably damaging 1.00
R1987:Pnpla6 UTSW 8 3542370 missense probably benign 0.00
R3079:Pnpla6 UTSW 8 3541512 missense probably benign 0.25
R3125:Pnpla6 UTSW 8 3534670 missense probably null 1.00
R4171:Pnpla6 UTSW 8 3543997 missense probably benign 0.09
R4281:Pnpla6 UTSW 8 3521513 missense probably damaging 1.00
R4674:Pnpla6 UTSW 8 3521412 missense probably damaging 1.00
R4776:Pnpla6 UTSW 8 3523818 missense probably benign 0.01
R4779:Pnpla6 UTSW 8 3522838 missense probably benign 0.00
R5114:Pnpla6 UTSW 8 3522613 missense probably damaging 0.98
R5459:Pnpla6 UTSW 8 3535829 missense probably benign 0.01
R5510:Pnpla6 UTSW 8 3521397 missense probably damaging 0.99
R5538:Pnpla6 UTSW 8 3531508 missense probably benign 0.01
R5664:Pnpla6 UTSW 8 3537478 missense probably damaging 0.98
R6063:Pnpla6 UTSW 8 3524156 missense probably benign 0.21
R6314:Pnpla6 UTSW 8 3521572 missense probably benign 0.39
R6321:Pnpla6 UTSW 8 3544015 missense probably benign
R6454:Pnpla6 UTSW 8 3537986 missense probably damaging 0.99
R6477:Pnpla6 UTSW 8 3536627 missense probably benign 0.00
R6524:Pnpla6 UTSW 8 3534519 splice site probably null
R6809:Pnpla6 UTSW 8 3534611 missense possibly damaging 0.72
R6975:Pnpla6 UTSW 8 3538068 missense probably damaging 1.00
R7293:Pnpla6 UTSW 8 3538068 missense probably damaging 1.00
R7389:Pnpla6 UTSW 8 3543981 nonsense probably null
R7520:Pnpla6 UTSW 8 3537508 missense probably damaging 1.00
R7666:Pnpla6 UTSW 8 3541591 missense probably benign 0.01
R7733:Pnpla6 UTSW 8 3522660 missense probably benign 0.01
R7743:Pnpla6 UTSW 8 3536594 missense possibly damaging 0.77
R7744:Pnpla6 UTSW 8 3531677 missense probably benign 0.38
X0018:Pnpla6 UTSW 8 3517337 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCCAAAACGGTCATTGCCATC -3'
(R):5'- TTTAACTTGGAGCCTCTGGGCAGC -3'

Sequencing Primer
(F):5'- TGGAAAAGGCTAAACCCCTG -3'
(R):5'- attgctacatcccgctcc -3'
Posted On2013-04-24