Incidental Mutation 'R3953:Adam2'
ID 308070
Institutional Source Beutler Lab
Gene Symbol Adam2
Ensembl Gene ENSMUSG00000022039
Gene Name a disintegrin and metallopeptidase domain 2
Synonyms fertilin beta, Ph30-beta, Ftnb
MMRRC Submission 040830-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3953 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 66264778-66315182 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 66295059 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Leucine at position 262 (S262L)
Ref Sequence ENSEMBL: ENSMUSP00000022618 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022618]
AlphaFold Q60718
Predicted Effect probably damaging
Transcript: ENSMUST00000022618
AA Change: S262L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022618
Gene: ENSMUSG00000022039
AA Change: S262L

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 17 147 2.1e-26 PFAM
Pfam:Reprolysin 184 381 7.1e-73 PFAM
DISIN 398 474 1.21e-27 SMART
ACR 475 612 6.96e-62 SMART
transmembrane domain 687 709 N/A INTRINSIC
low complexity region 721 733 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225667
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. This gene is predominantly expressed in the epididymis, where the encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Male mice lacking the encoded protein are infertile and exhibit multiple defects in reproduction. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene are viable, females are fertile, but males have severely reduced fertility. Mutant male sperm are defective in sperm-egg membrane adhesion, sperm-egg fusion, migration from the uterus to theoviduct, and binding to the egg zona pellucida. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf1 A G 17: 43,621,098 (GRCm39) N445S probably benign Het
Aldh7a1 C A 18: 56,681,577 (GRCm39) V198L probably damaging Het
Ank2 A T 3: 126,781,809 (GRCm39) D6E probably damaging Het
Arhgap31 A G 16: 38,423,826 (GRCm39) F747L probably benign Het
B4galt3 C A 1: 171,101,613 (GRCm39) H196N probably damaging Het
Cadps T C 14: 12,505,937 (GRCm38) D711G probably damaging Het
Clspn ACGGCGGCGGC A 4: 126,460,230 (GRCm39) probably null Het
Cpsf3 A G 12: 21,363,806 (GRCm39) D632G probably benign Het
Cyp4f18 C T 8: 72,754,801 (GRCm39) R148H probably damaging Het
Dennd4a C A 9: 64,759,857 (GRCm39) P321T probably damaging Het
Dennd5a A G 7: 109,504,906 (GRCm39) M868T probably benign Het
Dipk1b C T 2: 26,525,579 (GRCm39) P171L probably benign Het
Dnah2 G A 11: 69,344,929 (GRCm39) T2715M probably damaging Het
Evc2 T C 5: 37,537,931 (GRCm39) probably null Het
Fkbp8 T G 8: 70,987,517 (GRCm39) S376A probably damaging Het
Gucy1a2 T C 9: 3,582,704 (GRCm39) probably benign Het
Gys1 C T 7: 45,089,470 (GRCm39) P274S probably damaging Het
Hbq1a T C 11: 32,250,214 (GRCm39) probably null Het
Herc1 C T 9: 66,341,075 (GRCm39) Q1731* probably null Het
Igfn1 A G 1: 135,894,918 (GRCm39) Y1883H possibly damaging Het
Lmf1 G A 17: 25,873,445 (GRCm39) V317M probably damaging Het
Lnx1 T C 5: 74,766,750 (GRCm39) T455A probably benign Het
Mast2 A T 4: 116,170,926 (GRCm39) H612Q probably damaging Het
Mcm9 G A 10: 53,439,440 (GRCm39) H578Y probably damaging Het
Mefv A G 16: 3,533,264 (GRCm39) S336P possibly damaging Het
Micu1 A T 10: 59,586,326 (GRCm39) H134L probably benign Het
Mrgprb2 C T 7: 48,202,116 (GRCm39) G203D possibly damaging Het
Ncapd2 T C 6: 125,147,697 (GRCm39) I1179V probably damaging Het
Nek7 C A 1: 138,462,127 (GRCm39) C79F probably damaging Het
Nup210l A T 3: 90,100,361 (GRCm39) R1462S possibly damaging Het
Or14j6 A T 17: 38,214,500 (GRCm39) H21L probably benign Het
Or51f1 A G 7: 102,505,824 (GRCm39) C222R probably damaging Het
Or5al1 A G 2: 85,990,282 (GRCm39) V144A probably benign Het
Or5b119 G A 19: 13,456,806 (GRCm39) S252L probably benign Het
Pcnx3 A G 19: 5,733,808 (GRCm39) probably benign Het
Pi4ka A G 16: 17,103,145 (GRCm39) probably benign Het
Ptgir A G 7: 16,640,794 (GRCm39) M29V possibly damaging Het
Ptprb A G 10: 116,177,399 (GRCm39) N1320S probably benign Het
Ralgapa2 C T 2: 146,277,884 (GRCm39) V426I probably damaging Het
Rhobtb2 T C 14: 70,031,488 (GRCm39) T546A possibly damaging Het
Robo1 A G 16: 72,821,226 (GRCm39) D1331G probably damaging Het
Sgcz A G 8: 37,993,346 (GRCm39) probably benign Het
Slc26a1 T C 5: 108,821,448 (GRCm39) D147G possibly damaging Het
Slc44a5 A G 3: 153,877,209 (GRCm39) D13G probably benign Het
Slco1a1 A T 6: 141,868,833 (GRCm39) M377K probably damaging Het
St18 T A 1: 6,873,117 (GRCm39) L284Q probably damaging Het
Tbc1d9 C T 8: 83,960,161 (GRCm39) T138I probably damaging Het
Tec T C 5: 72,939,520 (GRCm39) probably null Het
Tln2 G A 9: 67,277,911 (GRCm39) P368S probably damaging Het
Tmem131l C A 3: 83,817,726 (GRCm39) C1257F probably damaging Het
Tmf1 C A 6: 97,153,167 (GRCm39) R302L probably damaging Het
Tnip3 A T 6: 65,574,379 (GRCm39) T137S possibly damaging Het
Trim30d C T 7: 104,121,728 (GRCm39) G339D probably damaging Het
Tspan32 T A 7: 142,560,735 (GRCm39) M61K probably damaging Het
Ttc6 T C 12: 57,744,238 (GRCm39) V1290A probably benign Het
Ttn A G 2: 76,799,593 (GRCm39) V429A possibly damaging Het
Vmn2r95 T A 17: 18,660,358 (GRCm39) Y257N possibly damaging Het
Vps13d A G 4: 144,875,450 (GRCm39) S1686P probably damaging Het
Wdr41 A G 13: 95,133,571 (GRCm39) E75G probably damaging Het
Other mutations in Adam2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Adam2 APN 14 66,311,498 (GRCm39) critical splice donor site probably null
IGL00980:Adam2 APN 14 66,293,977 (GRCm39) nonsense probably null
IGL01404:Adam2 APN 14 66,314,659 (GRCm39) critical splice donor site probably null
IGL01901:Adam2 APN 14 66,272,678 (GRCm39) splice site probably benign
IGL02687:Adam2 APN 14 66,306,639 (GRCm39) missense probably damaging 1.00
IGL02692:Adam2 APN 14 66,311,536 (GRCm39) missense probably damaging 1.00
IGL02695:Adam2 APN 14 66,287,929 (GRCm39) missense probably benign 0.01
IGL02798:Adam2 APN 14 66,277,724 (GRCm39) missense probably damaging 1.00
IGL03217:Adam2 APN 14 66,272,262 (GRCm39) missense possibly damaging 0.85
IGL03256:Adam2 APN 14 66,291,280 (GRCm39) missense probably benign 0.03
aldrin UTSW 14 66,295,086 (GRCm39) missense probably damaging 1.00
armstrong UTSW 14 66,275,006 (GRCm39) missense possibly damaging 0.95
sacher UTSW 14 66,306,007 (GRCm39) missense probably damaging 1.00
zuker UTSW 14 66,297,361 (GRCm39) missense probably benign 0.14
R0092:Adam2 UTSW 14 66,291,336 (GRCm39) missense probably damaging 1.00
R0281:Adam2 UTSW 14 66,275,055 (GRCm39) missense probably benign 0.20
R0636:Adam2 UTSW 14 66,272,265 (GRCm39) missense probably benign 0.03
R0690:Adam2 UTSW 14 66,295,095 (GRCm39) missense probably damaging 1.00
R0727:Adam2 UTSW 14 66,267,180 (GRCm39) missense probably damaging 1.00
R1477:Adam2 UTSW 14 66,315,149 (GRCm39) missense possibly damaging 0.96
R1634:Adam2 UTSW 14 66,295,180 (GRCm39) missense probably damaging 1.00
R1652:Adam2 UTSW 14 66,314,700 (GRCm39) missense probably benign 0.41
R1717:Adam2 UTSW 14 66,306,007 (GRCm39) missense probably damaging 1.00
R1868:Adam2 UTSW 14 66,315,107 (GRCm39) missense probably damaging 0.99
R1915:Adam2 UTSW 14 66,275,006 (GRCm39) missense possibly damaging 0.95
R3748:Adam2 UTSW 14 66,297,361 (GRCm39) missense probably benign 0.14
R3954:Adam2 UTSW 14 66,295,059 (GRCm39) missense probably damaging 1.00
R3955:Adam2 UTSW 14 66,295,059 (GRCm39) missense probably damaging 1.00
R3956:Adam2 UTSW 14 66,295,059 (GRCm39) missense probably damaging 1.00
R3957:Adam2 UTSW 14 66,295,059 (GRCm39) missense probably damaging 1.00
R4091:Adam2 UTSW 14 66,267,172 (GRCm39) missense probably damaging 0.97
R5673:Adam2 UTSW 14 66,306,681 (GRCm39) missense probably benign 0.03
R5761:Adam2 UTSW 14 66,283,595 (GRCm39) missense probably damaging 1.00
R6187:Adam2 UTSW 14 66,306,068 (GRCm39) missense possibly damaging 0.89
R6499:Adam2 UTSW 14 66,296,239 (GRCm39) missense probably damaging 1.00
R6730:Adam2 UTSW 14 66,275,025 (GRCm39) missense possibly damaging 0.83
R6829:Adam2 UTSW 14 66,265,446 (GRCm39) critical splice donor site probably null
R7023:Adam2 UTSW 14 66,280,505 (GRCm39) missense probably benign 0.22
R7168:Adam2 UTSW 14 66,296,241 (GRCm39) missense possibly damaging 0.89
R7228:Adam2 UTSW 14 66,291,361 (GRCm39) nonsense probably null
R7293:Adam2 UTSW 14 66,272,634 (GRCm39) missense probably benign 0.29
R7604:Adam2 UTSW 14 66,293,990 (GRCm39) missense probably benign 0.17
R7765:Adam2 UTSW 14 66,297,345 (GRCm39) missense probably damaging 1.00
R8380:Adam2 UTSW 14 66,275,006 (GRCm39) missense probably benign 0.01
R8532:Adam2 UTSW 14 66,293,970 (GRCm39) missense probably damaging 1.00
R8728:Adam2 UTSW 14 66,295,086 (GRCm39) missense probably damaging 1.00
R8744:Adam2 UTSW 14 66,272,165 (GRCm39) critical splice donor site probably null
R9282:Adam2 UTSW 14 66,267,238 (GRCm39) missense probably benign 0.00
R9307:Adam2 UTSW 14 66,287,921 (GRCm39) missense probably damaging 1.00
R9560:Adam2 UTSW 14 66,275,102 (GRCm39) missense probably benign 0.12
R9574:Adam2 UTSW 14 66,275,071 (GRCm39) missense probably benign 0.10
R9608:Adam2 UTSW 14 66,291,279 (GRCm39) missense probably null 0.05
X0061:Adam2 UTSW 14 66,291,354 (GRCm39) missense possibly damaging 0.66
Z1177:Adam2 UTSW 14 66,293,970 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCCCAATAAGAGCTGCATG -3'
(R):5'- TGACCTGAGCTTGATTTTGAAGC -3'

Sequencing Primer
(F):5'- GCCAGTTTTCCTCGGTATAG -3'
(R):5'- TGAAGCTCTTTTGCCCGG -3'
Posted On 2015-04-17