Incidental Mutation 'R3953:Pcnx3'
ID308082
Institutional Source Beutler Lab
Gene Symbol Pcnx3
Ensembl Gene ENSMUSG00000054874
Gene Namepecanex homolog 3
SynonymsPcnxl3
MMRRC Submission 040830-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3953 (G1)
Quality Score136
Status Validated
Chromosome19
Chromosomal Location5664635-5688908 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 5683780 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000068169] [ENSMUST00000113615] [ENSMUST00000141577]
Predicted Effect probably benign
Transcript: ENSMUST00000068169
SMART Domains Protein: ENSMUSP00000063786
Gene: ENSMUSG00000054874

DomainStartEndE-ValueType
transmembrane domain 36 53 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
low complexity region 99 111 N/A INTRINSIC
low complexity region 370 376 N/A INTRINSIC
transmembrane domain 385 407 N/A INTRINSIC
transmembrane domain 411 428 N/A INTRINSIC
transmembrane domain 441 463 N/A INTRINSIC
transmembrane domain 473 492 N/A INTRINSIC
transmembrane domain 501 523 N/A INTRINSIC
transmembrane domain 538 560 N/A INTRINSIC
transmembrane domain 573 592 N/A INTRINSIC
transmembrane domain 645 667 N/A INTRINSIC
transmembrane domain 669 691 N/A INTRINSIC
low complexity region 1011 1025 N/A INTRINSIC
Pfam:Pecanex_C 1159 1389 7.5e-124 PFAM
low complexity region 1462 1479 N/A INTRINSIC
low complexity region 1481 1510 N/A INTRINSIC
low complexity region 1525 1538 N/A INTRINSIC
low complexity region 1558 1569 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113615
SMART Domains Protein: ENSMUSP00000109245
Gene: ENSMUSG00000054874

DomainStartEndE-ValueType
transmembrane domain 36 53 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
low complexity region 99 111 N/A INTRINSIC
low complexity region 438 459 N/A INTRINSIC
low complexity region 778 784 N/A INTRINSIC
transmembrane domain 793 815 N/A INTRINSIC
transmembrane domain 819 836 N/A INTRINSIC
transmembrane domain 849 871 N/A INTRINSIC
transmembrane domain 881 900 N/A INTRINSIC
transmembrane domain 909 931 N/A INTRINSIC
transmembrane domain 946 968 N/A INTRINSIC
transmembrane domain 981 1000 N/A INTRINSIC
transmembrane domain 1053 1075 N/A INTRINSIC
transmembrane domain 1077 1099 N/A INTRINSIC
low complexity region 1419 1433 N/A INTRINSIC
Pfam:Pecanex_C 1570 1796 5.9e-116 PFAM
low complexity region 1870 1887 N/A INTRINSIC
low complexity region 1889 1918 N/A INTRINSIC
low complexity region 1933 1946 N/A INTRINSIC
low complexity region 1966 1977 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127876
SMART Domains Protein: ENSMUSP00000123696
Gene: ENSMUSG00000054874

DomainStartEndE-ValueType
low complexity region 69 75 N/A INTRINSIC
transmembrane domain 84 106 N/A INTRINSIC
transmembrane domain 110 127 N/A INTRINSIC
transmembrane domain 140 162 N/A INTRINSIC
transmembrane domain 172 191 N/A INTRINSIC
transmembrane domain 200 222 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135119
Predicted Effect probably benign
Transcript: ENSMUST00000137313
SMART Domains Protein: ENSMUSP00000115217
Gene: ENSMUSG00000054874

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
transmembrane domain 44 66 N/A INTRINSIC
transmembrane domain 79 98 N/A INTRINSIC
transmembrane domain 151 173 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141577
SMART Domains Protein: ENSMUSP00000116451
Gene: ENSMUSG00000054874

DomainStartEndE-ValueType
low complexity region 104 110 N/A INTRINSIC
transmembrane domain 119 141 N/A INTRINSIC
transmembrane domain 145 162 N/A INTRINSIC
transmembrane domain 175 197 N/A INTRINSIC
transmembrane domain 207 224 N/A INTRINSIC
transmembrane domain 229 251 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145270
SMART Domains Protein: ENSMUSP00000116493
Gene: ENSMUSG00000054874

DomainStartEndE-ValueType
low complexity region 199 205 N/A INTRINSIC
transmembrane domain 214 236 N/A INTRINSIC
transmembrane domain 240 257 N/A INTRINSIC
transmembrane domain 270 292 N/A INTRINSIC
transmembrane domain 302 321 N/A INTRINSIC
transmembrane domain 330 352 N/A INTRINSIC
transmembrane domain 367 389 N/A INTRINSIC
transmembrane domain 402 421 N/A INTRINSIC
transmembrane domain 474 496 N/A INTRINSIC
transmembrane domain 498 520 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147161
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184789
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam2 G A 14: 66,057,610 S262L probably damaging Het
Adgrf1 A G 17: 43,310,207 N445S probably benign Het
Aldh7a1 C A 18: 56,548,505 V198L probably damaging Het
Ank2 A T 3: 126,988,160 D6E probably damaging Het
Arhgap31 A G 16: 38,603,464 F747L probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Cadps T C 14: 12,505,937 D711G probably damaging Het
Clspn ACGGCGGCGGC A 4: 126,566,437 probably null Het
Cpsf3 A G 12: 21,313,805 D632G probably benign Het
Cyp4f18 C T 8: 72,000,957 R148H probably damaging Het
Dennd4a C A 9: 64,852,575 P321T probably damaging Het
Dennd5a A G 7: 109,905,699 M868T probably benign Het
Dnah2 G A 11: 69,454,103 T2715M probably damaging Het
Evc2 T C 5: 37,380,587 probably null Het
Fam69b C T 2: 26,635,567 P171L probably benign Het
Fkbp8 T G 8: 70,534,867 S376A probably damaging Het
Gucy1a2 T C 9: 3,582,704 probably benign Het
Gys1 C T 7: 45,440,046 P274S probably damaging Het
Hbq1a T C 11: 32,300,214 probably null Het
Herc1 C T 9: 66,433,793 Q1731* probably null Het
Igfn1 A G 1: 135,967,180 Y1883H possibly damaging Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Lnx1 T C 5: 74,606,089 T455A probably benign Het
Mast2 A T 4: 116,313,729 H612Q probably damaging Het
Mcm9 G A 10: 53,563,344 H578Y probably damaging Het
Mefv A G 16: 3,715,400 S336P possibly damaging Het
Micu1 A T 10: 59,750,504 H134L probably benign Het
Mrgprb2 C T 7: 48,552,368 G203D possibly damaging Het
Ncapd2 T C 6: 125,170,734 I1179V probably damaging Het
Nek7 C A 1: 138,534,389 C79F probably damaging Het
Nup210l A T 3: 90,193,054 R1462S possibly damaging Het
Olfr1042 A G 2: 86,159,938 V144A probably benign Het
Olfr127 A T 17: 37,903,609 H21L probably benign Het
Olfr1475 G A 19: 13,479,442 S252L probably benign Het
Olfr566 A G 7: 102,856,617 C222R probably damaging Het
Pi4ka A G 16: 17,285,281 probably benign Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Ptprb A G 10: 116,341,494 N1320S probably benign Het
Ralgapa2 C T 2: 146,435,964 V426I probably damaging Het
Rhobtb2 T C 14: 69,794,039 T546A possibly damaging Het
Robo1 A G 16: 73,024,338 D1331G probably damaging Het
Sgcz A G 8: 37,526,192 probably benign Het
Slc26a1 T C 5: 108,673,582 D147G possibly damaging Het
Slc44a5 A G 3: 154,171,572 D13G probably benign Het
Slco1a1 A T 6: 141,923,107 M377K probably damaging Het
St18 T A 1: 6,802,893 L284Q probably damaging Het
Tbc1d9 C T 8: 83,233,532 T138I probably damaging Het
Tec T C 5: 72,782,177 probably null Het
Tln2 G A 9: 67,370,629 P368S probably damaging Het
Tmem131l C A 3: 83,910,419 C1257F probably damaging Het
Tmf1 C A 6: 97,176,206 R302L probably damaging Het
Tnip3 A T 6: 65,597,395 T137S possibly damaging Het
Trim30d C T 7: 104,472,521 G339D probably damaging Het
Tspan32 T A 7: 143,006,998 M61K probably damaging Het
Ttc6 T C 12: 57,697,452 V1290A probably benign Het
Ttn A G 2: 76,969,249 V429A possibly damaging Het
Vmn2r95 T A 17: 18,440,096 Y257N possibly damaging Het
Vps13d A G 4: 145,148,880 S1686P probably damaging Het
Wdr41 A G 13: 94,997,063 E75G probably damaging Het
Other mutations in Pcnx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01616:Pcnx3 APN 19 5667259 unclassified probably benign
IGL01667:Pcnx3 APN 19 5686630 missense probably benign 0.03
IGL01704:Pcnx3 APN 19 5667476 missense probably damaging 1.00
IGL01752:Pcnx3 APN 19 5665337 nonsense probably null
IGL01791:Pcnx3 APN 19 5673267 missense probably benign 0.39
IGL01937:Pcnx3 APN 19 5677663 missense probably benign
IGL01987:Pcnx3 APN 19 5677479 missense probably damaging 1.00
IGL02073:Pcnx3 APN 19 5679386 missense probably damaging 0.99
IGL02417:Pcnx3 APN 19 5686481 missense possibly damaging 0.92
IGL03143:Pcnx3 APN 19 5685395 missense probably damaging 1.00
buns UTSW 19 5683340 start codon destroyed probably null
Pastries UTSW 19 5683339 nonsense probably null
Pecan UTSW 19 5672615 missense probably damaging 1.00
pie UTSW 19 5667158 missense possibly damaging 0.81
swirls UTSW 19 5672515 missense probably damaging 1.00
tip UTSW 19 5683780 splice site probably benign
PIT4453001:Pcnx3 UTSW 19 5672756 critical splice donor site probably null
R0234:Pcnx3 UTSW 19 5672618 missense probably benign 0.12
R0234:Pcnx3 UTSW 19 5672618 missense probably benign 0.12
R0360:Pcnx3 UTSW 19 5665583 missense probably damaging 0.98
R0687:Pcnx3 UTSW 19 5684333 missense probably damaging 1.00
R0718:Pcnx3 UTSW 19 5677728 splice site probably benign
R0840:Pcnx3 UTSW 19 5685701 unclassified probably null
R0907:Pcnx3 UTSW 19 5671525 missense possibly damaging 0.95
R1251:Pcnx3 UTSW 19 5677182 missense probably benign 0.03
R1373:Pcnx3 UTSW 19 5665516 missense probably damaging 0.97
R1467:Pcnx3 UTSW 19 5674894 missense possibly damaging 0.63
R1467:Pcnx3 UTSW 19 5674894 missense possibly damaging 0.63
R1572:Pcnx3 UTSW 19 5685347 nonsense probably null
R1602:Pcnx3 UTSW 19 5672515 missense probably damaging 1.00
R1628:Pcnx3 UTSW 19 5686065 missense probably damaging 0.99
R1635:Pcnx3 UTSW 19 5665745 missense probably benign 0.00
R1670:Pcnx3 UTSW 19 5673315 missense probably damaging 1.00
R1889:Pcnx3 UTSW 19 5672656 missense probably damaging 1.00
R1898:Pcnx3 UTSW 19 5672587 missense probably damaging 1.00
R2113:Pcnx3 UTSW 19 5671556 missense possibly damaging 0.93
R2147:Pcnx3 UTSW 19 5667605 missense probably damaging 1.00
R2358:Pcnx3 UTSW 19 5683339 nonsense probably null
R2358:Pcnx3 UTSW 19 5683340 start codon destroyed probably null
R2871:Pcnx3 UTSW 19 5683746 intron probably benign
R3699:Pcnx3 UTSW 19 5672465 missense probably damaging 1.00
R3712:Pcnx3 UTSW 19 5683339 nonsense probably null
R3712:Pcnx3 UTSW 19 5683340 start codon destroyed probably null
R3798:Pcnx3 UTSW 19 5678668 nonsense probably null
R3856:Pcnx3 UTSW 19 5678967 missense probably benign 0.02
R4613:Pcnx3 UTSW 19 5667219 missense possibly damaging 0.51
R4781:Pcnx3 UTSW 19 5687130 missense probably damaging 0.99
R4816:Pcnx3 UTSW 19 5687995 critical splice donor site probably null
R5338:Pcnx3 UTSW 19 5672596 missense probably damaging 1.00
R5770:Pcnx3 UTSW 19 5681579 intron probably benign
R5950:Pcnx3 UTSW 19 5667158 missense possibly damaging 0.81
R5951:Pcnx3 UTSW 19 5671680 missense possibly damaging 0.71
R5969:Pcnx3 UTSW 19 5685535 missense probably damaging 1.00
R6543:Pcnx3 UTSW 19 5665247 missense probably benign 0.07
R6704:Pcnx3 UTSW 19 5686487 missense possibly damaging 0.74
R7096:Pcnx3 UTSW 19 5672615 missense probably damaging 1.00
R7177:Pcnx3 UTSW 19 5687499 missense probably benign 0.01
R7308:Pcnx3 UTSW 19 5686147 missense possibly damaging 0.52
R7387:Pcnx3 UTSW 19 5673336 missense probably benign 0.33
R7488:Pcnx3 UTSW 19 5667459 missense possibly damaging 0.72
R7670:Pcnx3 UTSW 19 5677182 missense probably benign 0.03
X0028:Pcnx3 UTSW 19 5684427 missense probably damaging 1.00
X0053:Pcnx3 UTSW 19 5686622 splice site probably null
Predicted Primers PCR Primer
(F):5'- TACTCGAAAGCTGTACTCCCCTG -3'
(R):5'- TAACACTTGGTCCCTAGGGG -3'

Sequencing Primer
(F):5'- GCCCTCCTTCCAGAAGTCAG -3'
(R):5'- ATACCACAGGGCTCCTCCTTG -3'
Posted On2015-04-17