Incidental Mutation 'R3954:Ntng2'
ID308084
Institutional Source Beutler Lab
Gene Symbol Ntng2
Ensembl Gene ENSMUSG00000035513
Gene Namenetrin G2
SynonymsLmnt2, 2610016D08Rik
MMRRC Submission 040831-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.203) question?
Stock #R3954 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location29194541-29253005 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 29207535 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 305 (C305R)
Ref Sequence ENSEMBL: ENSMUSP00000071190 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048455] [ENSMUST00000071201] [ENSMUST00000091153] [ENSMUST00000102873] [ENSMUST00000177689] [ENSMUST00000183583]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048455
AA Change: C305R

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000035468
Gene: ENSMUSG00000035513
AA Change: C305R

DomainStartEndE-ValueType
LamNT 33 285 2.79e-15 SMART
EGF_Lam 287 344 1.41e-5 SMART
low complexity region 372 385 N/A INTRINSIC
EGF_Lam 413 466 5.28e-5 SMART
EGF_Lam 469 511 4.12e-7 SMART
EGF 515 547 2.26e-4 SMART
low complexity region 574 589 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000071201
AA Change: C305R

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000071190
Gene: ENSMUSG00000035513
AA Change: C305R

DomainStartEndE-ValueType
LamNT 33 285 2.79e-15 SMART
EGF_Lam 287 346 9.19e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000091153
AA Change: C305R

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000088688
Gene: ENSMUSG00000035513
AA Change: C305R

DomainStartEndE-ValueType
LamNT 33 285 2.79e-15 SMART
EGF_Lam 287 344 1.41e-5 SMART
EGF_Lam 388 441 5.28e-5 SMART
EGF_Lam 444 486 4.12e-7 SMART
EGF 490 522 2.26e-4 SMART
low complexity region 549 564 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000102873
AA Change: C305R

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099937
Gene: ENSMUSG00000035513
AA Change: C305R

DomainStartEndE-ValueType
LamNT 33 285 2.79e-15 SMART
EGF_Lam 287 344 1.41e-5 SMART
EGF_Lam 354 407 5.28e-5 SMART
EGF_Lam 410 452 4.12e-7 SMART
EGF 456 488 2.26e-4 SMART
low complexity region 515 530 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125765
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143194
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147274
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147897
Predicted Effect probably benign
Transcript: ENSMUST00000177689
AA Change: C305R

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000136659
Gene: ENSMUSG00000035513
AA Change: C305R

DomainStartEndE-ValueType
LamNT 33 285 2.79e-15 SMART
EGF_Lam 287 344 1.41e-5 SMART
EGF_Lam 354 407 5.28e-5 SMART
EGF_Lam 410 452 4.12e-7 SMART
EGF 456 488 2.26e-4 SMART
low complexity region 515 530 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000183583
AA Change: C305R

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000139034
Gene: ENSMUSG00000035513
AA Change: C305R

DomainStartEndE-ValueType
LamNT 33 285 2.79e-15 SMART
EGF_Lam 287 344 1.41e-5 SMART
low complexity region 345 368 N/A INTRINSIC
Meta Mutation Damage Score 0.9681 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to a subclass of the netrin family called netrin-G proteins. Unlike classic netrins, which act as diffusible chemoattractants, netrin-Gs are glycosylphosphatidylinositol-anchored membrane proteins that interact with specific transmembrane proteins. In mouse, this gene is preferentially expressed in the cerebral cortex, habenular nucleus and superior colliculus. Knockout mutant mice display a lack of behavioral startle in response to acoustic stimuli. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit an absence of startle reflex and abnormal ABR amplitude. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik A G 13: 58,384,389 S118P probably damaging Het
9330159F19Rik A G 10: 29,224,809 K393E possibly damaging Het
Aagab A G 9: 63,619,160 E155G probably damaging Het
Acad11 A G 9: 104,086,152 probably benign Het
Adam2 G A 14: 66,057,610 S262L probably damaging Het
Ankle2 A G 5: 110,251,675 T633A probably benign Het
Arhgef19 A G 4: 141,256,334 Y726C probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
B3galnt2 A G 13: 13,966,454 Q87R probably benign Het
Carmil1 A G 13: 24,013,407 S1349P probably benign Het
Ccdc114 A G 7: 45,941,676 K192E probably damaging Het
Cfap52 C A 11: 67,930,865 V446L probably benign Het
Cgnl1 T C 9: 71,724,663 N469D probably benign Het
Clspn ACGGCGGCGGC A 4: 126,566,437 probably null Het
Cpsf3 A G 12: 21,313,805 D632G probably benign Het
Cyp3a57 A T 5: 145,349,325 probably null Het
Dennd5a A G 7: 109,905,699 M868T probably benign Het
Dlg1 T C 16: 31,858,008 Y792H probably damaging Het
Dusp13 T A 14: 21,740,107 D57V probably damaging Het
Galnt6 A G 15: 100,697,168 V484A possibly damaging Het
Gm13128 A C 4: 144,331,668 M282L probably benign Het
Hbq1a T C 11: 32,300,214 probably null Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Igkv4-79 A G 6: 69,043,245 S29P possibly damaging Het
Lamp5 G A 2: 136,061,008 D216N probably damaging Het
Me2 A G 18: 73,781,132 F443L probably damaging Het
Ncam2 G A 16: 81,589,724 V664M probably damaging Het
Ndst4 T C 3: 125,437,905 M41T probably benign Het
Nkx6-3 G T 8: 23,153,726 A48S possibly damaging Het
Nup210l A T 3: 90,193,054 R1462S possibly damaging Het
Olfr566 A G 7: 102,856,617 C222R probably damaging Het
Omd A T 13: 49,589,737 I88F probably benign Het
Pi4k2a G A 19: 42,115,899 A367T probably damaging Het
Prph2 T C 17: 46,910,718 F8L probably benign Het
Rasgrf2 A G 13: 91,982,855 S696P probably damaging Het
Slc26a1 T C 5: 108,673,582 D147G possibly damaging Het
Tec T C 5: 72,782,177 probably null Het
Tmem131l C A 3: 83,910,419 C1257F probably damaging Het
Trim30d C T 7: 104,472,521 G339D probably damaging Het
Ttc6 T C 12: 57,697,452 V1290A probably benign Het
Vmn1r124 A G 7: 21,260,523 V32A possibly damaging Het
Zc3h13 T A 14: 75,329,738 S921T possibly damaging Het
Other mutations in Ntng2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0388:Ntng2 UTSW 2 29207426 missense probably damaging 1.00
R0526:Ntng2 UTSW 2 29197062 missense probably damaging 1.00
R1835:Ntng2 UTSW 2 29197057 nonsense probably null
R1961:Ntng2 UTSW 2 29197098 missense probably damaging 1.00
R2507:Ntng2 UTSW 2 29207519 missense probably damaging 1.00
R2920:Ntng2 UTSW 2 29204211 missense probably benign
R3944:Ntng2 UTSW 2 29204277 missense probably benign 0.02
R6235:Ntng2 UTSW 2 29227979 missense probably damaging 1.00
R6742:Ntng2 UTSW 2 29200928 missense probably benign
R6751:Ntng2 UTSW 2 29228043 missense possibly damaging 0.89
R6774:Ntng2 UTSW 2 29197090 missense probably damaging 1.00
R6907:Ntng2 UTSW 2 29228206 missense probably damaging 1.00
R6964:Ntng2 UTSW 2 29197029 missense probably benign 0.02
R6995:Ntng2 UTSW 2 29197068 missense probably damaging 1.00
R7214:Ntng2 UTSW 2 29227720 missense probably damaging 0.99
R7249:Ntng2 UTSW 2 29227992 missense probably benign 0.03
R7825:Ntng2 UTSW 2 29204078 missense probably benign 0.00
R8337:Ntng2 UTSW 2 29248038 start codon destroyed probably null 0.88
R8775:Ntng2 UTSW 2 29227964 missense possibly damaging 0.63
R8775-TAIL:Ntng2 UTSW 2 29227964 missense possibly damaging 0.63
X0023:Ntng2 UTSW 2 29197063 nonsense probably null
X0028:Ntng2 UTSW 2 29197149 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- TGTATCCATGTCAGCTGCCC -3'
(R):5'- GAGTGTGCAGTGGATCTCTC -3'

Sequencing Primer
(F):5'- TGCACGTGTGAGCCACC -3'
(R):5'- GTGCAGTGGATCTCTCCTCCAG -3'
Posted On2015-04-17