Incidental Mutation 'R3954:Nup210l'
ID 308088
Institutional Source Beutler Lab
Gene Symbol Nup210l
Ensembl Gene ENSMUSG00000027939
Gene Name nucleoporin 210-like
Synonyms 4930548O11Rik
MMRRC Submission 040831-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.432) question?
Stock # R3954 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 90011439-90119355 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 90100361 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 1462 (R1462S)
Ref Sequence ENSEMBL: ENSMUSP00000143368 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029548] [ENSMUST00000200410]
AlphaFold Q9D2F7
Predicted Effect possibly damaging
Transcript: ENSMUST00000029548
AA Change: R1462S

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000029548
Gene: ENSMUSG00000027939
AA Change: R1462S

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
BID_2 457 536 2.05e1 SMART
Blast:S1 949 1023 2e-16 BLAST
BID_2 1077 1152 4.51e-11 SMART
Blast:BID_2 1468 1550 7e-15 BLAST
transmembrane domain 1807 1829 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000200410
AA Change: R1462S

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143368
Gene: ENSMUSG00000027939
AA Change: R1462S

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
BID_2 457 536 6.9e-2 SMART
Blast:S1 938 1023 9e-17 BLAST
BID_2 1077 1152 1.5e-13 SMART
Blast:BID_2 1468 1550 7e-15 BLAST
transmembrane domain 1807 1829 N/A INTRINSIC
Meta Mutation Damage Score 0.2372 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (42/43)
MGI Phenotype PHENOTYPE: Mice homozygous for a transgene insertion exhibit male infertility, asthenozoospermia, teratozoospermia, azoospermia, and seminiferous tubule degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik A G 10: 29,100,805 (GRCm39) K393E possibly damaging Het
Aagab A G 9: 63,526,442 (GRCm39) E155G probably damaging Het
Acad11 A G 9: 103,963,351 (GRCm39) probably benign Het
Adam2 G A 14: 66,295,059 (GRCm39) S262L probably damaging Het
Ankle2 A G 5: 110,399,541 (GRCm39) T633A probably benign Het
Arhgef19 A G 4: 140,983,645 (GRCm39) Y726C probably damaging Het
Arsi G A 18: 61,049,723 (GRCm39) G202E probably benign Het
B3galnt2 A G 13: 14,141,039 (GRCm39) Q87R probably benign Het
Carmil1 A G 13: 24,197,390 (GRCm39) S1349P probably benign Het
Cfap52 C A 11: 67,821,691 (GRCm39) V446L probably benign Het
Cgnl1 T C 9: 71,631,945 (GRCm39) N469D probably benign Het
Clspn ACGGCGGCGGC A 4: 126,460,230 (GRCm39) probably null Het
Cpsf3 A G 12: 21,363,806 (GRCm39) D632G probably benign Het
Cyp3a57 A T 5: 145,286,135 (GRCm39) probably null Het
Dennd5a A G 7: 109,504,906 (GRCm39) M868T probably benign Het
Dlg1 T C 16: 31,676,826 (GRCm39) Y792H probably damaging Het
Dusp13b T A 14: 21,790,175 (GRCm39) D57V probably damaging Het
Galnt6 A G 15: 100,595,049 (GRCm39) V484A possibly damaging Het
Hbq1a T C 11: 32,250,214 (GRCm39) probably null Het
Hivep2 C A 10: 14,004,713 (GRCm39) T437K probably benign Het
Igkv4-79 A G 6: 69,020,229 (GRCm39) S29P possibly damaging Het
Lamp5 G A 2: 135,902,928 (GRCm39) D216N probably damaging Het
Me2 A G 18: 73,914,203 (GRCm39) F443L probably damaging Het
Ncam2 G A 16: 81,386,612 (GRCm39) V664M probably damaging Het
Ndst4 T C 3: 125,231,554 (GRCm39) M41T probably benign Het
Nkx6-3 G T 8: 23,643,742 (GRCm39) A48S possibly damaging Het
Ntng2 A G 2: 29,097,547 (GRCm39) C305R probably damaging Het
Odad1 A G 7: 45,591,100 (GRCm39) K192E probably damaging Het
Omd A T 13: 49,743,213 (GRCm39) I88F probably benign Het
Or51f1 A G 7: 102,505,824 (GRCm39) C222R probably damaging Het
Pi4k2a G A 19: 42,104,338 (GRCm39) A367T probably damaging Het
Pramel30 A C 4: 144,058,238 (GRCm39) M282L probably benign Het
Prph2 T C 17: 47,221,644 (GRCm39) F8L probably benign Het
Qng1 A G 13: 58,532,203 (GRCm39) S118P probably damaging Het
Rasgrf2 A G 13: 92,130,974 (GRCm39) S696P probably damaging Het
Slc26a1 T C 5: 108,821,448 (GRCm39) D147G possibly damaging Het
Tec T C 5: 72,939,520 (GRCm39) probably null Het
Tmem131l C A 3: 83,817,726 (GRCm39) C1257F probably damaging Het
Trim30d C T 7: 104,121,728 (GRCm39) G339D probably damaging Het
Ttc6 T C 12: 57,744,238 (GRCm39) V1290A probably benign Het
Vmn1r124 A G 7: 20,994,448 (GRCm39) V32A possibly damaging Het
Zc3h13 T A 14: 75,567,178 (GRCm39) S921T possibly damaging Het
Other mutations in Nup210l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Nup210l APN 3 90,098,156 (GRCm39) splice site probably benign
IGL00813:Nup210l APN 3 90,039,725 (GRCm39) missense probably benign 0.00
IGL01375:Nup210l APN 3 90,067,200 (GRCm39) missense probably damaging 0.96
IGL01731:Nup210l APN 3 90,061,873 (GRCm39) missense probably damaging 1.00
IGL01786:Nup210l APN 3 90,030,083 (GRCm39) nonsense probably null
IGL01958:Nup210l APN 3 90,111,231 (GRCm39) missense possibly damaging 0.74
IGL02094:Nup210l APN 3 90,087,520 (GRCm39) critical splice donor site probably null
IGL02120:Nup210l APN 3 90,044,169 (GRCm39) missense probably damaging 1.00
IGL02313:Nup210l APN 3 90,030,099 (GRCm39) missense probably damaging 1.00
IGL02336:Nup210l APN 3 90,088,859 (GRCm39) critical splice donor site probably null
IGL02348:Nup210l APN 3 90,011,471 (GRCm39) utr 5 prime probably benign
IGL02372:Nup210l APN 3 90,109,278 (GRCm39) missense possibly damaging 0.80
IGL02557:Nup210l APN 3 90,031,537 (GRCm39) missense probably damaging 1.00
IGL02559:Nup210l APN 3 90,067,260 (GRCm39) missense probably benign 0.02
IGL02738:Nup210l APN 3 90,044,157 (GRCm39) missense possibly damaging 0.80
IGL03231:Nup210l APN 3 90,096,852 (GRCm39) missense probably damaging 1.00
IGL03257:Nup210l APN 3 90,087,455 (GRCm39) critical splice acceptor site probably null
IGL03388:Nup210l APN 3 90,077,351 (GRCm39) missense probably damaging 1.00
IGL03134:Nup210l UTSW 3 90,098,194 (GRCm39) missense possibly damaging 0.85
R0003:Nup210l UTSW 3 90,027,218 (GRCm39) missense probably damaging 1.00
R0040:Nup210l UTSW 3 90,089,212 (GRCm39) missense probably damaging 1.00
R0083:Nup210l UTSW 3 90,096,882 (GRCm39) missense probably damaging 1.00
R0090:Nup210l UTSW 3 90,119,086 (GRCm39) missense probably benign 0.00
R0108:Nup210l UTSW 3 90,096,882 (GRCm39) missense probably damaging 1.00
R0142:Nup210l UTSW 3 90,079,420 (GRCm39) missense probably damaging 1.00
R0306:Nup210l UTSW 3 90,114,675 (GRCm39) missense probably benign 0.13
R0332:Nup210l UTSW 3 90,039,616 (GRCm39) splice site probably benign
R0346:Nup210l UTSW 3 90,096,745 (GRCm39) missense probably damaging 1.00
R0463:Nup210l UTSW 3 90,087,518 (GRCm39) missense probably null 1.00
R0622:Nup210l UTSW 3 90,075,047 (GRCm39) missense probably damaging 0.98
R0765:Nup210l UTSW 3 90,027,184 (GRCm39) missense probably damaging 0.99
R0990:Nup210l UTSW 3 90,119,232 (GRCm39) missense probably benign 0.00
R1014:Nup210l UTSW 3 90,077,355 (GRCm39) missense possibly damaging 0.62
R1036:Nup210l UTSW 3 90,100,247 (GRCm39) splice site probably benign
R1177:Nup210l UTSW 3 90,109,310 (GRCm39) missense probably benign 0.11
R1183:Nup210l UTSW 3 90,067,252 (GRCm39) missense probably benign 0.04
R1188:Nup210l UTSW 3 90,105,486 (GRCm39) missense probably benign 0.16
R1457:Nup210l UTSW 3 90,098,279 (GRCm39) missense possibly damaging 0.68
R1471:Nup210l UTSW 3 90,077,869 (GRCm39) missense probably benign
R1627:Nup210l UTSW 3 90,051,476 (GRCm39) missense probably benign 0.15
R1778:Nup210l UTSW 3 90,096,793 (GRCm39) missense probably damaging 0.99
R1827:Nup210l UTSW 3 90,061,864 (GRCm39) missense probably damaging 1.00
R1843:Nup210l UTSW 3 90,079,393 (GRCm39) missense probably damaging 0.96
R1858:Nup210l UTSW 3 90,061,806 (GRCm39) missense probably damaging 0.97
R1942:Nup210l UTSW 3 90,058,544 (GRCm39) missense probably benign 0.01
R2015:Nup210l UTSW 3 90,092,739 (GRCm39) missense probably damaging 1.00
R2113:Nup210l UTSW 3 90,098,281 (GRCm39) missense possibly damaging 0.48
R2944:Nup210l UTSW 3 90,088,852 (GRCm39) missense probably damaging 1.00
R3736:Nup210l UTSW 3 90,027,320 (GRCm39) missense probably damaging 1.00
R3740:Nup210l UTSW 3 90,114,701 (GRCm39) missense probably benign 0.08
R3741:Nup210l UTSW 3 90,114,701 (GRCm39) missense probably benign 0.08
R3742:Nup210l UTSW 3 90,114,701 (GRCm39) missense probably benign 0.08
R3771:Nup210l UTSW 3 90,027,201 (GRCm39) nonsense probably null
R3773:Nup210l UTSW 3 90,027,201 (GRCm39) nonsense probably null
R3879:Nup210l UTSW 3 90,092,780 (GRCm39) missense probably damaging 1.00
R3882:Nup210l UTSW 3 90,031,517 (GRCm39) missense probably benign 0.19
R3953:Nup210l UTSW 3 90,100,361 (GRCm39) missense possibly damaging 0.89
R3955:Nup210l UTSW 3 90,100,361 (GRCm39) missense possibly damaging 0.89
R3956:Nup210l UTSW 3 90,100,361 (GRCm39) missense possibly damaging 0.89
R4200:Nup210l UTSW 3 90,027,218 (GRCm39) missense probably damaging 1.00
R4290:Nup210l UTSW 3 90,114,633 (GRCm39) missense probably benign 0.00
R4328:Nup210l UTSW 3 90,083,142 (GRCm39) splice site probably null
R4629:Nup210l UTSW 3 90,098,181 (GRCm39) nonsense probably null
R4629:Nup210l UTSW 3 90,075,182 (GRCm39) missense probably benign 0.21
R4897:Nup210l UTSW 3 90,100,378 (GRCm39) missense probably damaging 1.00
R4906:Nup210l UTSW 3 90,077,337 (GRCm39) missense probably benign 0.06
R4966:Nup210l UTSW 3 90,014,208 (GRCm39) missense probably benign 0.00
R5004:Nup210l UTSW 3 90,087,472 (GRCm39) nonsense probably null
R5237:Nup210l UTSW 3 90,087,505 (GRCm39) missense probably benign 0.00
R5499:Nup210l UTSW 3 90,081,677 (GRCm39) missense probably damaging 1.00
R5522:Nup210l UTSW 3 90,061,972 (GRCm39) missense probably benign 0.10
R5627:Nup210l UTSW 3 90,051,557 (GRCm39) missense probably damaging 0.97
R5678:Nup210l UTSW 3 90,098,266 (GRCm39) missense probably damaging 0.99
R5726:Nup210l UTSW 3 90,036,514 (GRCm39) splice site probably null
R5792:Nup210l UTSW 3 90,107,164 (GRCm39) missense probably damaging 1.00
R6129:Nup210l UTSW 3 90,011,483 (GRCm39) missense probably benign 0.00
R6272:Nup210l UTSW 3 90,077,331 (GRCm39) missense possibly damaging 0.57
R6290:Nup210l UTSW 3 90,027,216 (GRCm39) nonsense probably null
R6293:Nup210l UTSW 3 90,022,371 (GRCm39) missense probably damaging 1.00
R6446:Nup210l UTSW 3 90,079,375 (GRCm39) missense probably damaging 1.00
R6698:Nup210l UTSW 3 90,089,815 (GRCm39) missense possibly damaging 0.57
R6855:Nup210l UTSW 3 90,044,231 (GRCm39) missense probably benign 0.01
R6895:Nup210l UTSW 3 90,067,231 (GRCm39) missense probably damaging 0.97
R6899:Nup210l UTSW 3 90,075,204 (GRCm39) missense possibly damaging 0.77
R6978:Nup210l UTSW 3 90,061,873 (GRCm39) missense possibly damaging 0.86
R6980:Nup210l UTSW 3 90,027,234 (GRCm39) missense probably benign 0.04
R7038:Nup210l UTSW 3 90,067,254 (GRCm39) missense probably damaging 1.00
R7273:Nup210l UTSW 3 90,025,854 (GRCm39) missense probably benign 0.04
R7450:Nup210l UTSW 3 90,022,495 (GRCm39) critical splice donor site probably null
R7514:Nup210l UTSW 3 90,117,766 (GRCm39) critical splice donor site probably null
R7658:Nup210l UTSW 3 90,119,300 (GRCm39) missense probably benign 0.43
R7735:Nup210l UTSW 3 90,092,883 (GRCm39) missense probably damaging 1.00
R7772:Nup210l UTSW 3 90,067,233 (GRCm39) missense probably damaging 1.00
R7800:Nup210l UTSW 3 90,041,904 (GRCm39) missense probably damaging 1.00
R7840:Nup210l UTSW 3 90,030,036 (GRCm39) missense probably benign 0.08
R7847:Nup210l UTSW 3 90,058,430 (GRCm39) missense probably benign
R7848:Nup210l UTSW 3 90,111,212 (GRCm39) missense probably benign 0.01
R8084:Nup210l UTSW 3 90,043,365 (GRCm39) missense probably benign 0.15
R8121:Nup210l UTSW 3 90,022,428 (GRCm39) missense probably damaging 1.00
R8421:Nup210l UTSW 3 90,111,174 (GRCm39) missense probably damaging 1.00
R8458:Nup210l UTSW 3 90,092,874 (GRCm39) missense probably null 1.00
R8701:Nup210l UTSW 3 90,030,121 (GRCm39) missense probably benign 0.41
R8720:Nup210l UTSW 3 90,117,681 (GRCm39) missense probably benign 0.00
R8770:Nup210l UTSW 3 90,025,850 (GRCm39) missense probably damaging 1.00
R8896:Nup210l UTSW 3 90,025,932 (GRCm39) missense probably damaging 1.00
R9033:Nup210l UTSW 3 90,105,396 (GRCm39) missense probably benign
R9371:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9373:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9381:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9426:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9427:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9501:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9523:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9574:Nup210l UTSW 3 90,117,693 (GRCm39) missense probably benign
R9612:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9654:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9660:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9660:Nup210l UTSW 3 90,105,402 (GRCm39) missense probably benign 0.30
R9662:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9682:Nup210l UTSW 3 90,051,469 (GRCm39) missense possibly damaging 0.79
R9729:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9750:Nup210l UTSW 3 90,117,659 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CCAAACTGCTTTCTGCTGGC -3'
(R):5'- GCTAGAATGCCCAATAATGAAATGC -3'

Sequencing Primer
(F):5'- TGCATGCTGGCCCAACATC -3'
(R):5'- GGACAGGGTCTCATTATATAGCCC -3'
Posted On 2015-04-17