Incidental Mutation 'R3954:Arhgef19'
ID308091
Institutional Source Beutler Lab
Gene Symbol Arhgef19
Ensembl Gene ENSMUSG00000028919
Gene NameRho guanine nucleotide exchange factor (GEF) 19
Synonyms6430573B13Rik, WGEF
MMRRC Submission 040831-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.305) question?
Stock #R3954 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location141239499-141257564 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 141256334 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 726 (Y726C)
Ref Sequence ENSEMBL: ENSMUSP00000006618 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006618]
Predicted Effect probably damaging
Transcript: ENSMUST00000006618
AA Change: Y726C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000006618
Gene: ENSMUSG00000028919
AA Change: Y726C

DomainStartEndE-ValueType
low complexity region 145 160 N/A INTRINSIC
low complexity region 161 172 N/A INTRINSIC
low complexity region 305 331 N/A INTRINSIC
RhoGEF 380 559 5.51e-43 SMART
PH 593 706 8.86e-6 SMART
SH3 718 775 5.16e-10 SMART
Meta Mutation Damage Score 0.9138 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Guanine nucleotide exchange factors (GEFs) such as ARHGEF19 accelerate the GTPase activity of Rho GTPases (see RHOA, MIM 165390).[supplied by OMIM, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik A G 13: 58,384,389 S118P probably damaging Het
9330159F19Rik A G 10: 29,224,809 K393E possibly damaging Het
Aagab A G 9: 63,619,160 E155G probably damaging Het
Acad11 A G 9: 104,086,152 probably benign Het
Adam2 G A 14: 66,057,610 S262L probably damaging Het
Ankle2 A G 5: 110,251,675 T633A probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
B3galnt2 A G 13: 13,966,454 Q87R probably benign Het
Carmil1 A G 13: 24,013,407 S1349P probably benign Het
Ccdc114 A G 7: 45,941,676 K192E probably damaging Het
Cfap52 C A 11: 67,930,865 V446L probably benign Het
Cgnl1 T C 9: 71,724,663 N469D probably benign Het
Clspn ACGGCGGCGGC A 4: 126,566,437 probably null Het
Cpsf3 A G 12: 21,313,805 D632G probably benign Het
Cyp3a57 A T 5: 145,349,325 probably null Het
Dennd5a A G 7: 109,905,699 M868T probably benign Het
Dlg1 T C 16: 31,858,008 Y792H probably damaging Het
Dusp13 T A 14: 21,740,107 D57V probably damaging Het
Galnt6 A G 15: 100,697,168 V484A possibly damaging Het
Gm13128 A C 4: 144,331,668 M282L probably benign Het
Hbq1a T C 11: 32,300,214 probably null Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Igkv4-79 A G 6: 69,043,245 S29P possibly damaging Het
Lamp5 G A 2: 136,061,008 D216N probably damaging Het
Me2 A G 18: 73,781,132 F443L probably damaging Het
Ncam2 G A 16: 81,589,724 V664M probably damaging Het
Ndst4 T C 3: 125,437,905 M41T probably benign Het
Nkx6-3 G T 8: 23,153,726 A48S possibly damaging Het
Ntng2 A G 2: 29,207,535 C305R probably damaging Het
Nup210l A T 3: 90,193,054 R1462S possibly damaging Het
Olfr566 A G 7: 102,856,617 C222R probably damaging Het
Omd A T 13: 49,589,737 I88F probably benign Het
Pi4k2a G A 19: 42,115,899 A367T probably damaging Het
Prph2 T C 17: 46,910,718 F8L probably benign Het
Rasgrf2 A G 13: 91,982,855 S696P probably damaging Het
Slc26a1 T C 5: 108,673,582 D147G possibly damaging Het
Tec T C 5: 72,782,177 probably null Het
Tmem131l C A 3: 83,910,419 C1257F probably damaging Het
Trim30d C T 7: 104,472,521 G339D probably damaging Het
Ttc6 T C 12: 57,697,452 V1290A probably benign Het
Vmn1r124 A G 7: 21,260,523 V32A possibly damaging Het
Zc3h13 T A 14: 75,329,738 S921T possibly damaging Het
Other mutations in Arhgef19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00958:Arhgef19 APN 4 141248983 unclassified probably benign
IGL02037:Arhgef19 APN 4 141246396 missense probably damaging 0.99
IGL03049:Arhgef19 APN 4 141254316 missense probably damaging 0.98
IGL03071:Arhgef19 APN 4 141249002 missense possibly damaging 0.88
IGL03098:Arhgef19 UTSW 4 141247568 missense possibly damaging 0.85
R0271:Arhgef19 UTSW 4 141250607 missense probably benign 0.00
R0319:Arhgef19 UTSW 4 141256399 missense possibly damaging 0.63
R1572:Arhgef19 UTSW 4 141254754 missense probably benign 0.10
R1633:Arhgef19 UTSW 4 141238560 unclassified probably benign
R1735:Arhgef19 UTSW 4 141249618 missense possibly damaging 0.55
R1752:Arhgef19 UTSW 4 141251043 missense probably benign 0.27
R1823:Arhgef19 UTSW 4 141249146 missense probably benign 0.01
R1889:Arhgef19 UTSW 4 141249313 missense probably damaging 1.00
R2138:Arhgef19 UTSW 4 141250800 missense probably damaging 1.00
R2280:Arhgef19 UTSW 4 141246516 missense probably benign 0.14
R3430:Arhgef19 UTSW 4 141256800 missense probably benign 0.03
R4158:Arhgef19 UTSW 4 141246349 missense possibly damaging 0.50
R4160:Arhgef19 UTSW 4 141246349 missense possibly damaging 0.50
R4995:Arhgef19 UTSW 4 141247515 unclassified probably null
R5031:Arhgef19 UTSW 4 141250810 missense probably damaging 0.98
R5782:Arhgef19 UTSW 4 141256312 missense probably damaging 1.00
R5913:Arhgef19 UTSW 4 141249298 missense probably benign 0.03
R7614:Arhgef19 UTSW 4 141256779 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- AGAGGTCAGTTCGAGGTGTC -3'
(R):5'- TGGTCTAACCAGATTCCCGAATG -3'

Sequencing Primer
(F):5'- CGAGGTGTCACTGTGAGC -3'
(R):5'- TAACCAGATTCCCGAATGCTGTGG -3'
Posted On2015-04-17