Incidental Mutation 'R3954:Slc26a1'
ID308095
Institutional Source Beutler Lab
Gene Symbol Slc26a1
Ensembl Gene ENSMUSG00000046959
Gene Namesolute carrier family 26 (sulfate transporter), member 1
SynonymsSat1
MMRRC Submission 040831-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.392) question?
Stock #R3954 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location108669878-108675569 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108673582 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 147 (D147G)
Ref Sequence ENSEMBL: ENSMUSP00000131282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051757] [ENSMUST00000071650] [ENSMUST00000112563] [ENSMUST00000119212] [ENSMUST00000119270] [ENSMUST00000132708] [ENSMUST00000136227] [ENSMUST00000139734] [ENSMUST00000140620] [ENSMUST00000163328]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051757
AA Change: D147G

PolyPhen 2 Score 0.849 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000051561
Gene: ENSMUSG00000046959
AA Change: D147G

DomainStartEndE-ValueType
Pfam:Sulfate_tra_GLY 54 137 4.9e-31 PFAM
Pfam:Sulfate_transp 200 478 3.1e-84 PFAM
Pfam:STAS 536 686 9.5e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000071650
SMART Domains Protein: ENSMUSP00000071577
Gene: ENSMUSG00000033540

DomainStartEndE-ValueType
Pfam:Glyco_hydro_39 22 542 1.4e-223 PFAM
SCOP:d1bpv__ 546 643 3e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112563
SMART Domains Protein: ENSMUSP00000108182
Gene: ENSMUSG00000033540

DomainStartEndE-ValueType
Pfam:Glyco_hydro_39 22 542 2.1e-224 PFAM
SCOP:d1bpv__ 546 643 3e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119212
SMART Domains Protein: ENSMUSP00000113190
Gene: ENSMUSG00000033540

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Glyco_hydro_39 48 495 2.4e-193 PFAM
SCOP:d1bpv__ 499 596 3e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000119270
AA Change: D163G

PolyPhen 2 Score 0.849 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113185
Gene: ENSMUSG00000046959
AA Change: D163G

DomainStartEndE-ValueType
Pfam:Sulfate_transp 85 498 7.3e-135 PFAM
Pfam:STAS 552 702 1.1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132708
SMART Domains Protein: ENSMUSP00000122837
Gene: ENSMUSG00000004815

DomainStartEndE-ValueType
Blast:C1 26 56 2e-13 BLAST
low complexity region 68 81 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000136227
AA Change: D147G

PolyPhen 2 Score 0.849 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000116540
Gene: ENSMUSG00000046959
AA Change: D147G

DomainStartEndE-ValueType
Pfam:Sulfate_tra_GLY 54 137 3.4e-31 PFAM
Pfam:Sulfate_transp 200 416 2.2e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139734
SMART Domains Protein: ENSMUSP00000117694
Gene: ENSMUSG00000033540

DomainStartEndE-ValueType
Pfam:Glyco_hydro_39 22 199 6.8e-80 PFAM
low complexity region 235 260 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140620
SMART Domains Protein: ENSMUSP00000119624
Gene: ENSMUSG00000033540

DomainStartEndE-ValueType
Pfam:Glyco_hydro_39 22 150 3.4e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151445
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159464
Predicted Effect possibly damaging
Transcript: ENSMUST00000163328
AA Change: D147G

PolyPhen 2 Score 0.849 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000131282
Gene: ENSMUSG00000046959
AA Change: D147G

DomainStartEndE-ValueType
Pfam:Sulfate_tra_GLY 54 137 4.9e-31 PFAM
Pfam:Sulfate_transp 200 478 3.1e-84 PFAM
Pfam:STAS 536 686 9.5e-29 PFAM
Meta Mutation Damage Score 0.0997 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a family of sulfate/anion transporter genes. Family members are well conserved in their genomic (number and size of exons) and protein (aa length among species) structures, but have markedly different tissue expression patterns. This gene is primarily expressed in the liver, pancreas, and brain. Three splice variants that encode different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene develop kidney stones and have an increased susceptibility to acetaminophen-induced liver damage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik A G 13: 58,384,389 S118P probably damaging Het
9330159F19Rik A G 10: 29,224,809 K393E possibly damaging Het
Aagab A G 9: 63,619,160 E155G probably damaging Het
Acad11 A G 9: 104,086,152 probably benign Het
Adam2 G A 14: 66,057,610 S262L probably damaging Het
Ankle2 A G 5: 110,251,675 T633A probably benign Het
Arhgef19 A G 4: 141,256,334 Y726C probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
B3galnt2 A G 13: 13,966,454 Q87R probably benign Het
Carmil1 A G 13: 24,013,407 S1349P probably benign Het
Ccdc114 A G 7: 45,941,676 K192E probably damaging Het
Cfap52 C A 11: 67,930,865 V446L probably benign Het
Cgnl1 T C 9: 71,724,663 N469D probably benign Het
Clspn ACGGCGGCGGC A 4: 126,566,437 probably null Het
Cpsf3 A G 12: 21,313,805 D632G probably benign Het
Cyp3a57 A T 5: 145,349,325 probably null Het
Dennd5a A G 7: 109,905,699 M868T probably benign Het
Dlg1 T C 16: 31,858,008 Y792H probably damaging Het
Dusp13 T A 14: 21,740,107 D57V probably damaging Het
Galnt6 A G 15: 100,697,168 V484A possibly damaging Het
Gm13128 A C 4: 144,331,668 M282L probably benign Het
Hbq1a T C 11: 32,300,214 probably null Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Igkv4-79 A G 6: 69,043,245 S29P possibly damaging Het
Lamp5 G A 2: 136,061,008 D216N probably damaging Het
Me2 A G 18: 73,781,132 F443L probably damaging Het
Ncam2 G A 16: 81,589,724 V664M probably damaging Het
Ndst4 T C 3: 125,437,905 M41T probably benign Het
Nkx6-3 G T 8: 23,153,726 A48S possibly damaging Het
Ntng2 A G 2: 29,207,535 C305R probably damaging Het
Nup210l A T 3: 90,193,054 R1462S possibly damaging Het
Olfr566 A G 7: 102,856,617 C222R probably damaging Het
Omd A T 13: 49,589,737 I88F probably benign Het
Pi4k2a G A 19: 42,115,899 A367T probably damaging Het
Prph2 T C 17: 46,910,718 F8L probably benign Het
Rasgrf2 A G 13: 91,982,855 S696P probably damaging Het
Tec T C 5: 72,782,177 probably null Het
Tmem131l C A 3: 83,910,419 C1257F probably damaging Het
Trim30d C T 7: 104,472,521 G339D probably damaging Het
Ttc6 T C 12: 57,697,452 V1290A probably benign Het
Vmn1r124 A G 7: 21,260,523 V32A possibly damaging Het
Zc3h13 T A 14: 75,329,738 S921T possibly damaging Het
Other mutations in Slc26a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01082:Slc26a1 APN 5 108671878 missense possibly damaging 0.75
IGL02566:Slc26a1 APN 5 108673799 missense probably damaging 1.00
IGL03347:Slc26a1 APN 5 108673810 missense probably damaging 1.00
R0744:Slc26a1 UTSW 5 108673523 missense probably benign 0.01
R0833:Slc26a1 UTSW 5 108673523 missense probably benign 0.01
R1518:Slc26a1 UTSW 5 108671874 nonsense probably null
R1726:Slc26a1 UTSW 5 108673675 missense probably damaging 1.00
R1766:Slc26a1 UTSW 5 108671792 missense probably damaging 1.00
R1975:Slc26a1 UTSW 5 108672472 missense probably damaging 1.00
R3953:Slc26a1 UTSW 5 108673582 missense possibly damaging 0.85
R3955:Slc26a1 UTSW 5 108673582 missense possibly damaging 0.85
R3969:Slc26a1 UTSW 5 108673952 missense probably benign
R4259:Slc26a1 UTSW 5 108672630 missense probably damaging 1.00
R5875:Slc26a1 UTSW 5 108672037 missense probably damaging 1.00
R6036:Slc26a1 UTSW 5 108673570 missense probably damaging 1.00
R6036:Slc26a1 UTSW 5 108673570 missense probably damaging 1.00
R6057:Slc26a1 UTSW 5 108673765 missense probably damaging 1.00
R6088:Slc26a1 UTSW 5 108674006 missense possibly damaging 0.84
R6766:Slc26a1 UTSW 5 108671907 missense probably damaging 0.99
R7230:Slc26a1 UTSW 5 108671745 missense probably damaging 1.00
R7294:Slc26a1 UTSW 5 108673832 missense possibly damaging 0.90
R7580:Slc26a1 UTSW 5 108671869 missense probably damaging 1.00
R8396:Slc26a1 UTSW 5 108673849 missense probably benign
R8833:Slc26a1 UTSW 5 108672316 missense probably benign 0.02
Z1176:Slc26a1 UTSW 5 108672431 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGCAGCTAACTCTTTACCTG -3'
(R):5'- TAGCAGGTGATGTCATGTCAGG -3'

Sequencing Primer
(F):5'- TTTACCTGATAAAGCCCGGC -3'
(R):5'- GCATTATCCTGGTGCCACAG -3'
Posted On2015-04-17