Incidental Mutation 'R3954:Ankle2'
ID308096
Institutional Source Beutler Lab
Gene Symbol Ankle2
Ensembl Gene ENSMUSG00000029501
Gene Nameankyrin repeat and LEM domain containing 2
Synonyms1110001J12Rik, D5Ertd585e
MMRRC Submission 040831-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.947) question?
Stock #R3954 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location110231004-110256651 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 110251675 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 633 (T633A)
Ref Sequence ENSEMBL: ENSMUSP00000031474 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031474] [ENSMUST00000086674] [ENSMUST00000197188]
Predicted Effect probably benign
Transcript: ENSMUST00000031474
AA Change: T633A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000031474
Gene: ENSMUSG00000029501
AA Change: T633A

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
Pfam:LEM 74 112 6.6e-12 PFAM
ANK 358 387 7.75e2 SMART
ANK 419 448 3.31e-1 SMART
low complexity region 923 937 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000086674
AA Change: T634A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000083878
Gene: ENSMUSG00000029501
AA Change: T634A

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
Pfam:LEM 75 114 5.8e-9 PFAM
ANK 358 387 7.75e2 SMART
ANK 419 448 3.31e-1 SMART
low complexity region 845 859 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196821
Predicted Effect probably benign
Transcript: ENSMUST00000197188
AA Change: T634A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000143044
Gene: ENSMUSG00000029501
AA Change: T634A

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
Pfam:LEM 75 114 6.4e-9 PFAM
ANK 358 387 7.75e2 SMART
ANK 419 448 3.31e-1 SMART
low complexity region 923 937 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the LEM family of inner nuclear membrane proteins. The encoded protein functions as a mitotic regulator through postmitotic formation of the nuclear envelope. Mutations in this gene cause morphology defects in the nuclear envelope and BAF hyperphosphorylation. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik A G 13: 58,384,389 S118P probably damaging Het
9330159F19Rik A G 10: 29,224,809 K393E possibly damaging Het
Aagab A G 9: 63,619,160 E155G probably damaging Het
Acad11 A G 9: 104,086,152 probably benign Het
Adam2 G A 14: 66,057,610 S262L probably damaging Het
Arhgef19 A G 4: 141,256,334 Y726C probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
B3galnt2 A G 13: 13,966,454 Q87R probably benign Het
Carmil1 A G 13: 24,013,407 S1349P probably benign Het
Ccdc114 A G 7: 45,941,676 K192E probably damaging Het
Cfap52 C A 11: 67,930,865 V446L probably benign Het
Cgnl1 T C 9: 71,724,663 N469D probably benign Het
Clspn ACGGCGGCGGC A 4: 126,566,437 probably null Het
Cpsf3 A G 12: 21,313,805 D632G probably benign Het
Cyp3a57 A T 5: 145,349,325 probably null Het
Dennd5a A G 7: 109,905,699 M868T probably benign Het
Dlg1 T C 16: 31,858,008 Y792H probably damaging Het
Dusp13 T A 14: 21,740,107 D57V probably damaging Het
Galnt6 A G 15: 100,697,168 V484A possibly damaging Het
Gm13128 A C 4: 144,331,668 M282L probably benign Het
Hbq1a T C 11: 32,300,214 probably null Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Igkv4-79 A G 6: 69,043,245 S29P possibly damaging Het
Lamp5 G A 2: 136,061,008 D216N probably damaging Het
Me2 A G 18: 73,781,132 F443L probably damaging Het
Ncam2 G A 16: 81,589,724 V664M probably damaging Het
Ndst4 T C 3: 125,437,905 M41T probably benign Het
Nkx6-3 G T 8: 23,153,726 A48S possibly damaging Het
Ntng2 A G 2: 29,207,535 C305R probably damaging Het
Nup210l A T 3: 90,193,054 R1462S possibly damaging Het
Olfr566 A G 7: 102,856,617 C222R probably damaging Het
Omd A T 13: 49,589,737 I88F probably benign Het
Pi4k2a G A 19: 42,115,899 A367T probably damaging Het
Prph2 T C 17: 46,910,718 F8L probably benign Het
Rasgrf2 A G 13: 91,982,855 S696P probably damaging Het
Slc26a1 T C 5: 108,673,582 D147G possibly damaging Het
Tec T C 5: 72,782,177 probably null Het
Tmem131l C A 3: 83,910,419 C1257F probably damaging Het
Trim30d C T 7: 104,472,521 G339D probably damaging Het
Ttc6 T C 12: 57,697,452 V1290A probably benign Het
Vmn1r124 A G 7: 21,260,523 V32A possibly damaging Het
Zc3h13 T A 14: 75,329,738 S921T possibly damaging Het
Other mutations in Ankle2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01312:Ankle2 APN 5 110234352 missense probably benign 0.01
IGL03030:Ankle2 APN 5 110251610 missense possibly damaging 0.93
R0107:Ankle2 UTSW 5 110253027 missense probably benign
R0219:Ankle2 UTSW 5 110251645 nonsense probably null
R0288:Ankle2 UTSW 5 110236390 missense probably damaging 0.96
R0511:Ankle2 UTSW 5 110242059 splice site probably benign
R1343:Ankle2 UTSW 5 110237966 missense probably damaging 1.00
R2079:Ankle2 UTSW 5 110244505 missense probably damaging 1.00
R4161:Ankle2 UTSW 5 110234368 missense probably benign 0.06
R4196:Ankle2 UTSW 5 110244543 missense possibly damaging 0.81
R4613:Ankle2 UTSW 5 110231379 missense probably benign
R4830:Ankle2 UTSW 5 110242013 missense probably damaging 1.00
R4870:Ankle2 UTSW 5 110251478 splice site probably null
R4946:Ankle2 UTSW 5 110253838 missense probably benign 0.06
R5537:Ankle2 UTSW 5 110249495 missense probably damaging 1.00
R5798:Ankle2 UTSW 5 110251535 missense probably damaging 1.00
R5809:Ankle2 UTSW 5 110237990 missense probably damaging 0.99
R6434:Ankle2 UTSW 5 110253893 missense probably damaging 1.00
R6825:Ankle2 UTSW 5 110250769 missense probably null 0.78
R7264:Ankle2 UTSW 5 110237823 missense probably damaging 1.00
R7296:Ankle2 UTSW 5 110237724 missense probably damaging 1.00
R7318:Ankle2 UTSW 5 110237766 missense probably benign 0.19
R7429:Ankle2 UTSW 5 110234518 missense possibly damaging 0.86
R8035:Ankle2 UTSW 5 110254452 missense probably damaging 1.00
R8079:Ankle2 UTSW 5 110231316 missense probably damaging 1.00
R8257:Ankle2 UTSW 5 110253915 critical splice donor site probably null
R8348:Ankle2 UTSW 5 110242043 missense possibly damaging 0.68
R8448:Ankle2 UTSW 5 110242043 missense possibly damaging 0.68
R8478:Ankle2 UTSW 5 110252952 missense possibly damaging 0.92
R8957:Ankle2 UTSW 5 110231255 missense possibly damaging 0.95
X0026:Ankle2 UTSW 5 110253120 missense probably benign 0.01
X0065:Ankle2 UTSW 5 110236357 missense probably damaging 0.99
Z1176:Ankle2 UTSW 5 110234499 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- ACAGGGAGCTAGCTCATGAG -3'
(R):5'- CACGTTGCTTGCTGTGATTC -3'

Sequencing Primer
(F):5'- TTGATCTGTCTTCCCAGG -3'
(R):5'- GTGCTCCAGACACATAGAGCTG -3'
Posted On2015-04-17