Incidental Mutation 'R3954:Cyp3a57'
ID308097
Institutional Source Beutler Lab
Gene Symbol Cyp3a57
Ensembl Gene ENSMUSG00000070419
Gene Namecytochrome P450, family 3, subfamily a, polypeptide 57
SynonymsEG622127
MMRRC Submission 040831-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R3954 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location145345279-145390926 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to T at 145349325 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000078251 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079268] [ENSMUST00000079268] [ENSMUST00000174696] [ENSMUST00000174696]
Predicted Effect probably null
Transcript: ENSMUST00000079268
SMART Domains Protein: ENSMUSP00000078251
Gene: ENSMUSG00000070419

DomainStartEndE-ValueType
Pfam:p450 38 493 6.5e-131 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000079268
SMART Domains Protein: ENSMUSP00000078251
Gene: ENSMUSG00000070419

DomainStartEndE-ValueType
Pfam:p450 38 493 6.5e-131 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174696
SMART Domains Protein: ENSMUSP00000133600
Gene: ENSMUSG00000070419

DomainStartEndE-ValueType
Pfam:p450 38 147 1.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174696
SMART Domains Protein: ENSMUSP00000133600
Gene: ENSMUSG00000070419

DomainStartEndE-ValueType
Pfam:p450 38 147 1.8e-21 PFAM
Meta Mutation Damage Score 0.9713 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (42/43)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik A G 13: 58,384,389 S118P probably damaging Het
9330159F19Rik A G 10: 29,224,809 K393E possibly damaging Het
Aagab A G 9: 63,619,160 E155G probably damaging Het
Acad11 A G 9: 104,086,152 probably benign Het
Adam2 G A 14: 66,057,610 S262L probably damaging Het
Ankle2 A G 5: 110,251,675 T633A probably benign Het
Arhgef19 A G 4: 141,256,334 Y726C probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
B3galnt2 A G 13: 13,966,454 Q87R probably benign Het
Carmil1 A G 13: 24,013,407 S1349P probably benign Het
Ccdc114 A G 7: 45,941,676 K192E probably damaging Het
Cfap52 C A 11: 67,930,865 V446L probably benign Het
Cgnl1 T C 9: 71,724,663 N469D probably benign Het
Clspn ACGGCGGCGGC A 4: 126,566,437 probably null Het
Cpsf3 A G 12: 21,313,805 D632G probably benign Het
Dennd5a A G 7: 109,905,699 M868T probably benign Het
Dlg1 T C 16: 31,858,008 Y792H probably damaging Het
Dusp13 T A 14: 21,740,107 D57V probably damaging Het
Galnt6 A G 15: 100,697,168 V484A possibly damaging Het
Gm13128 A C 4: 144,331,668 M282L probably benign Het
Hbq1a T C 11: 32,300,214 probably null Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Igkv4-79 A G 6: 69,043,245 S29P possibly damaging Het
Lamp5 G A 2: 136,061,008 D216N probably damaging Het
Me2 A G 18: 73,781,132 F443L probably damaging Het
Ncam2 G A 16: 81,589,724 V664M probably damaging Het
Ndst4 T C 3: 125,437,905 M41T probably benign Het
Nkx6-3 G T 8: 23,153,726 A48S possibly damaging Het
Ntng2 A G 2: 29,207,535 C305R probably damaging Het
Nup210l A T 3: 90,193,054 R1462S possibly damaging Het
Olfr566 A G 7: 102,856,617 C222R probably damaging Het
Omd A T 13: 49,589,737 I88F probably benign Het
Pi4k2a G A 19: 42,115,899 A367T probably damaging Het
Prph2 T C 17: 46,910,718 F8L probably benign Het
Rasgrf2 A G 13: 91,982,855 S696P probably damaging Het
Slc26a1 T C 5: 108,673,582 D147G possibly damaging Het
Tec T C 5: 72,782,177 probably null Het
Tmem131l C A 3: 83,910,419 C1257F probably damaging Het
Trim30d C T 7: 104,472,521 G339D probably damaging Het
Ttc6 T C 12: 57,697,452 V1290A probably benign Het
Vmn1r124 A G 7: 21,260,523 V32A possibly damaging Het
Zc3h13 T A 14: 75,329,738 S921T possibly damaging Het
Other mutations in Cyp3a57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Cyp3a57 APN 5 145371024 missense probably damaging 1.00
IGL00656:Cyp3a57 APN 5 145372549 missense possibly damaging 0.55
IGL01368:Cyp3a57 APN 5 145369068 missense probably damaging 0.99
IGL01602:Cyp3a57 APN 5 145387044 missense probably damaging 1.00
IGL01605:Cyp3a57 APN 5 145387044 missense probably damaging 1.00
IGL01924:Cyp3a57 APN 5 145372629 missense probably benign
IGL02191:Cyp3a57 APN 5 145365685 missense probably damaging 1.00
IGL02213:Cyp3a57 APN 5 145381280 missense probably damaging 1.00
IGL02217:Cyp3a57 APN 5 145369143 splice site probably null
R0141:Cyp3a57 UTSW 5 145362102 missense probably benign 0.05
R0720:Cyp3a57 UTSW 5 145390403 splice site probably benign
R0765:Cyp3a57 UTSW 5 145390410 splice site probably benign
R0976:Cyp3a57 UTSW 5 145390468 missense probably benign 0.01
R1494:Cyp3a57 UTSW 5 145381267 missense probably damaging 0.97
R1624:Cyp3a57 UTSW 5 145390415 critical splice acceptor site probably null
R1732:Cyp3a57 UTSW 5 145365645 missense probably damaging 1.00
R1791:Cyp3a57 UTSW 5 145371010 missense probably benign 0.06
R1839:Cyp3a57 UTSW 5 145381301 missense probably damaging 1.00
R1858:Cyp3a57 UTSW 5 145381249 missense probably damaging 1.00
R2095:Cyp3a57 UTSW 5 145369134 nonsense probably null
R2305:Cyp3a57 UTSW 5 145381280 missense probably damaging 1.00
R4289:Cyp3a57 UTSW 5 145349397 missense probably damaging 1.00
R4463:Cyp3a57 UTSW 5 145381274 missense probably damaging 1.00
R4579:Cyp3a57 UTSW 5 145374264 missense probably benign 0.00
R4598:Cyp3a57 UTSW 5 145390417 missense probably benign 0.01
R4678:Cyp3a57 UTSW 5 145370728 splice site probably null
R4853:Cyp3a57 UTSW 5 145365679 missense probably damaging 1.00
R4954:Cyp3a57 UTSW 5 145370955 critical splice acceptor site probably null
R4977:Cyp3a57 UTSW 5 145349426 splice site probably null
R5162:Cyp3a57 UTSW 5 145369083 missense probably damaging 1.00
R5226:Cyp3a57 UTSW 5 145365697 missense probably benign 0.04
R5470:Cyp3a57 UTSW 5 145372619 missense probably benign 0.12
R5568:Cyp3a57 UTSW 5 145370646 missense probably benign 0.01
R5652:Cyp3a57 UTSW 5 145349325 critical splice acceptor site probably null
R5872:Cyp3a57 UTSW 5 145371057 nonsense probably null
R6855:Cyp3a57 UTSW 5 145372566 missense probably damaging 0.97
R6861:Cyp3a57 UTSW 5 145370963 missense possibly damaging 0.85
R6893:Cyp3a57 UTSW 5 145386974 nonsense probably null
R7081:Cyp3a57 UTSW 5 145381373 missense probably damaging 1.00
R7305:Cyp3a57 UTSW 5 145370985 missense probably benign 0.03
Z1177:Cyp3a57 UTSW 5 145365633 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCCCATCATTTTGACATTGTAGG -3'
(R):5'- TTGCCACTATAAGAAATGAAAGAGC -3'

Sequencing Primer
(F):5'- TTTGACATTGTAGGAAATTGGAGAG -3'
(R):5'- AATTCTAGCACTCTGGAGGC -3'
Posted On2015-04-17