Incidental Mutation 'R3954:Ccdc114'
ID308100
Institutional Source Beutler Lab
Gene Symbol Ccdc114
Ensembl Gene ENSMUSG00000040189
Gene Namecoiled-coil domain containing 114
Synonyms
MMRRC Submission 040831-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R3954 (G1)
Quality Score177
Status Validated
Chromosome7
Chromosomal Location45924072-45948963 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45941676 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 192 (K192E)
Ref Sequence ENSEMBL: ENSMUSP00000042772 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038720] [ENSMUST00000210867]
Predicted Effect probably damaging
Transcript: ENSMUST00000038720
AA Change: K192E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000042772
Gene: ENSMUSG00000040189
AA Change: K192E

DomainStartEndE-ValueType
coiled coil region 11 94 N/A INTRINSIC
coiled coil region 137 156 N/A INTRINSIC
low complexity region 174 185 N/A INTRINSIC
coiled coil region 195 229 N/A INTRINSIC
coiled coil region 303 380 N/A INTRINSIC
low complexity region 434 445 N/A INTRINSIC
low complexity region 504 519 N/A INTRINSIC
low complexity region 558 588 N/A INTRINSIC
low complexity region 592 604 N/A INTRINSIC
low complexity region 621 656 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000210867
AA Change: Q169R
Meta Mutation Damage Score 0.0649 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil domain-containing protein that is a component of the outer dynein arm docking complex in cilia cells. Mutations in this gene may cause primary ciliary dyskinesia 20. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik A G 13: 58,384,389 S118P probably damaging Het
9330159F19Rik A G 10: 29,224,809 K393E possibly damaging Het
Aagab A G 9: 63,619,160 E155G probably damaging Het
Acad11 A G 9: 104,086,152 probably benign Het
Adam2 G A 14: 66,057,610 S262L probably damaging Het
Ankle2 A G 5: 110,251,675 T633A probably benign Het
Arhgef19 A G 4: 141,256,334 Y726C probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
B3galnt2 A G 13: 13,966,454 Q87R probably benign Het
Carmil1 A G 13: 24,013,407 S1349P probably benign Het
Cfap52 C A 11: 67,930,865 V446L probably benign Het
Cgnl1 T C 9: 71,724,663 N469D probably benign Het
Clspn ACGGCGGCGGC A 4: 126,566,437 probably null Het
Cpsf3 A G 12: 21,313,805 D632G probably benign Het
Cyp3a57 A T 5: 145,349,325 probably null Het
Dennd5a A G 7: 109,905,699 M868T probably benign Het
Dlg1 T C 16: 31,858,008 Y792H probably damaging Het
Dusp13 T A 14: 21,740,107 D57V probably damaging Het
Galnt6 A G 15: 100,697,168 V484A possibly damaging Het
Gm13128 A C 4: 144,331,668 M282L probably benign Het
Hbq1a T C 11: 32,300,214 probably null Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Igkv4-79 A G 6: 69,043,245 S29P possibly damaging Het
Lamp5 G A 2: 136,061,008 D216N probably damaging Het
Me2 A G 18: 73,781,132 F443L probably damaging Het
Ncam2 G A 16: 81,589,724 V664M probably damaging Het
Ndst4 T C 3: 125,437,905 M41T probably benign Het
Nkx6-3 G T 8: 23,153,726 A48S possibly damaging Het
Ntng2 A G 2: 29,207,535 C305R probably damaging Het
Nup210l A T 3: 90,193,054 R1462S possibly damaging Het
Olfr566 A G 7: 102,856,617 C222R probably damaging Het
Omd A T 13: 49,589,737 I88F probably benign Het
Pi4k2a G A 19: 42,115,899 A367T probably damaging Het
Prph2 T C 17: 46,910,718 F8L probably benign Het
Rasgrf2 A G 13: 91,982,855 S696P probably damaging Het
Slc26a1 T C 5: 108,673,582 D147G possibly damaging Het
Tec T C 5: 72,782,177 probably null Het
Tmem131l C A 3: 83,910,419 C1257F probably damaging Het
Trim30d C T 7: 104,472,521 G339D probably damaging Het
Ttc6 T C 12: 57,697,452 V1290A probably benign Het
Vmn1r124 A G 7: 21,260,523 V32A possibly damaging Het
Zc3h13 T A 14: 75,329,738 S921T possibly damaging Het
Other mutations in Ccdc114
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00975:Ccdc114 APN 7 45942656 missense probably damaging 1.00
IGL01383:Ccdc114 APN 7 45939700 missense probably damaging 1.00
IGL01826:Ccdc114 APN 7 45948386 missense possibly damaging 0.62
R0865:Ccdc114 UTSW 7 45942088 missense probably benign 0.17
R1061:Ccdc114 UTSW 7 45941755 missense probably damaging 0.96
R1217:Ccdc114 UTSW 7 45942758 splice site probably benign
R1533:Ccdc114 UTSW 7 45942858 missense probably benign 0.00
R2863:Ccdc114 UTSW 7 45948312 missense probably benign 0.04
R4774:Ccdc114 UTSW 7 45948380 missense probably damaging 0.99
R4861:Ccdc114 UTSW 7 45942873 missense probably damaging 0.98
R4861:Ccdc114 UTSW 7 45942873 missense probably damaging 0.98
R4952:Ccdc114 UTSW 7 45942191 missense probably damaging 1.00
R5074:Ccdc114 UTSW 7 45929090 missense probably benign 0.05
R5187:Ccdc114 UTSW 7 45929116 missense probably damaging 1.00
R5265:Ccdc114 UTSW 7 45947435 missense probably damaging 1.00
R5364:Ccdc114 UTSW 7 45936332 missense probably damaging 0.99
R5377:Ccdc114 UTSW 7 45942082 nonsense probably null
R6221:Ccdc114 UTSW 7 45947479 missense probably damaging 1.00
R6246:Ccdc114 UTSW 7 45936364 missense probably damaging 1.00
R6324:Ccdc114 UTSW 7 45941710 missense probably damaging 1.00
R6389:Ccdc114 UTSW 7 45948516 missense probably benign 0.32
R6542:Ccdc114 UTSW 7 45948390 missense probably benign 0.00
R6593:Ccdc114 UTSW 7 45947384 missense probably damaging 0.96
R7215:Ccdc114 UTSW 7 45936622 missense probably damaging 1.00
R7401:Ccdc114 UTSW 7 45942765 missense probably damaging 1.00
R7431:Ccdc114 UTSW 7 45929246 missense probably damaging 0.99
R7725:Ccdc114 UTSW 7 45948411 missense probably damaging 0.98
R7878:Ccdc114 UTSW 7 45924560 missense possibly damaging 0.91
R8036:Ccdc114 UTSW 7 45942852 missense probably benign 0.06
R8681:Ccdc114 UTSW 7 45941839 missense probably damaging 0.96
R8686:Ccdc114 UTSW 7 45947692 missense probably benign 0.20
X0064:Ccdc114 UTSW 7 45948393 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GTCATAGCTAGTCCTGATCCTGATC -3'
(R):5'- TGATAGCTGTAGTGGCCCTG -3'

Sequencing Primer
(F):5'- GATCTAGGTCTTCCAGCCTAGAAC -3'
(R):5'- TGCAAGCACTGGCCTCAC -3'
Posted On2015-04-17