Incidental Mutation 'R3954:Olfr566'
ID308101
Institutional Source Beutler Lab
Gene Symbol Olfr566
Ensembl Gene ENSMUSG00000060888
Gene Nameolfactory receptor 566
SynonymsMOR14-7P, GA_x6K02T2PBJ9-5560696-5559746
MMRRC Submission 040831-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R3954 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location102855337-102858765 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102856617 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 222 (C222R)
Ref Sequence ENSEMBL: ENSMUSP00000148998 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071393] [ENSMUST00000209952] [ENSMUST00000213481]
Predicted Effect probably damaging
Transcript: ENSMUST00000071393
AA Change: C219R

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000071344
Gene: ENSMUSG00000060888
AA Change: C219R

DomainStartEndE-ValueType
Pfam:7tm_4 37 316 1e-110 PFAM
Pfam:7TM_GPCR_Srsx 42 313 3.5e-6 PFAM
Pfam:7tm_1 47 298 9.3e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000209952
AA Change: C222R

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210522
Predicted Effect probably damaging
Transcript: ENSMUST00000213481
AA Change: C222R

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
Meta Mutation Damage Score 0.4469 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik A G 13: 58,384,389 S118P probably damaging Het
9330159F19Rik A G 10: 29,224,809 K393E possibly damaging Het
Aagab A G 9: 63,619,160 E155G probably damaging Het
Acad11 A G 9: 104,086,152 probably benign Het
Adam2 G A 14: 66,057,610 S262L probably damaging Het
Ankle2 A G 5: 110,251,675 T633A probably benign Het
Arhgef19 A G 4: 141,256,334 Y726C probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
B3galnt2 A G 13: 13,966,454 Q87R probably benign Het
Carmil1 A G 13: 24,013,407 S1349P probably benign Het
Ccdc114 A G 7: 45,941,676 K192E probably damaging Het
Cfap52 C A 11: 67,930,865 V446L probably benign Het
Cgnl1 T C 9: 71,724,663 N469D probably benign Het
Clspn ACGGCGGCGGC A 4: 126,566,437 probably null Het
Cpsf3 A G 12: 21,313,805 D632G probably benign Het
Cyp3a57 A T 5: 145,349,325 probably null Het
Dennd5a A G 7: 109,905,699 M868T probably benign Het
Dlg1 T C 16: 31,858,008 Y792H probably damaging Het
Dusp13 T A 14: 21,740,107 D57V probably damaging Het
Galnt6 A G 15: 100,697,168 V484A possibly damaging Het
Gm13128 A C 4: 144,331,668 M282L probably benign Het
Hbq1a T C 11: 32,300,214 probably null Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Igkv4-79 A G 6: 69,043,245 S29P possibly damaging Het
Lamp5 G A 2: 136,061,008 D216N probably damaging Het
Me2 A G 18: 73,781,132 F443L probably damaging Het
Ncam2 G A 16: 81,589,724 V664M probably damaging Het
Ndst4 T C 3: 125,437,905 M41T probably benign Het
Nkx6-3 G T 8: 23,153,726 A48S possibly damaging Het
Ntng2 A G 2: 29,207,535 C305R probably damaging Het
Nup210l A T 3: 90,193,054 R1462S possibly damaging Het
Omd A T 13: 49,589,737 I88F probably benign Het
Pi4k2a G A 19: 42,115,899 A367T probably damaging Het
Prph2 T C 17: 46,910,718 F8L probably benign Het
Rasgrf2 A G 13: 91,982,855 S696P probably damaging Het
Slc26a1 T C 5: 108,673,582 D147G possibly damaging Het
Tec T C 5: 72,782,177 probably null Het
Tmem131l C A 3: 83,910,419 C1257F probably damaging Het
Trim30d C T 7: 104,472,521 G339D probably damaging Het
Ttc6 T C 12: 57,697,452 V1290A probably benign Het
Vmn1r124 A G 7: 21,260,523 V32A possibly damaging Het
Zc3h13 T A 14: 75,329,738 S921T possibly damaging Het
Other mutations in Olfr566
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02295:Olfr566 APN 7 102856824 missense probably benign
IGL03336:Olfr566 APN 7 102856616 missense probably benign 0.38
PIT4382001:Olfr566 UTSW 7 102856602 missense probably damaging 1.00
R1337:Olfr566 UTSW 7 102856871 missense probably benign 0.03
R1791:Olfr566 UTSW 7 102856362 nonsense probably null
R3953:Olfr566 UTSW 7 102856617 missense probably damaging 0.97
R3955:Olfr566 UTSW 7 102856617 missense probably damaging 0.97
R3957:Olfr566 UTSW 7 102856617 missense probably damaging 0.97
R4734:Olfr566 UTSW 7 102856979 missense probably damaging 0.99
R5182:Olfr566 UTSW 7 102856969 missense probably benign 0.07
R5394:Olfr566 UTSW 7 102856479 missense probably damaging 1.00
R5559:Olfr566 UTSW 7 102857207 missense possibly damaging 0.94
R6023:Olfr566 UTSW 7 102856962 missense possibly damaging 0.95
R6310:Olfr566 UTSW 7 102857205 missense probably benign 0.01
R7312:Olfr566 UTSW 7 102856499 missense probably damaging 1.00
R7493:Olfr566 UTSW 7 102857071 nonsense probably null
R8409:Olfr566 UTSW 7 102857270 missense probably benign 0.01
R8476:Olfr566 UTSW 7 102856945 missense probably benign 0.22
R8747:Olfr566 UTSW 7 102856932 missense probably benign 0.05
Z1177:Olfr566 UTSW 7 102856374 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AACATTGGCCATCATTGTATGG -3'
(R):5'- CCTAGTGATAATGCGTGCTCTG -3'

Sequencing Primer
(F):5'- GGCCATCATTGTATGGACTACC -3'
(R):5'- ATGCGTGCTCTGTTATTAATAGTCC -3'
Posted On2015-04-17