Incidental Mutation 'R3954:Acad11'
ID308108
Institutional Source Beutler Lab
Gene Symbol Acad11
Ensembl Gene ENSMUSG00000090150
Gene Nameacyl-Coenzyme A dehydrogenase family, member 11
Synonyms5730439E10Rik
MMRRC Submission 040831-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R3954 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location104063377-104127725 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 104086152 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047799] [ENSMUST00000120854] [ENSMUST00000189998]
Predicted Effect probably benign
Transcript: ENSMUST00000047799
SMART Domains Protein: ENSMUSP00000043424
Gene: ENSMUSG00000090150

DomainStartEndE-ValueType
Pfam:APH 43 307 3.5e-45 PFAM
Pfam:Acyl-CoA_dh_N 376 498 1.5e-13 PFAM
Pfam:Acyl-CoA_dh_M 502 605 1.7e-21 PFAM
Pfam:Acyl-CoA_dh_1 617 768 2.7e-36 PFAM
Pfam:Acyl-CoA_dh_2 632 743 2e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000050139
SMART Domains Protein: ENSMUSP00000062941
Gene: ENSMUSG00000041748

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120854
SMART Domains Protein: ENSMUSP00000112994
Gene: ENSMUSG00000090150

DomainStartEndE-ValueType
Pfam:APH 1 188 1.1e-28 PFAM
Pfam:EcKinase 49 143 4.8e-9 PFAM
Pfam:Acyl-CoA_dh_N 257 380 8.7e-15 PFAM
Pfam:Acyl-CoA_dh_M 385 439 2.4e-19 PFAM
Pfam:Acyl-CoA_dh_1 499 650 1.3e-37 PFAM
Pfam:Acyl-CoA_dh_2 514 632 2.7e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154431
Predicted Effect probably benign
Transcript: ENSMUST00000189998
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an acyl-CoA dehydrogenase enzyme with a preference for carbon chain lengths between 20 and 26. Naturally occurring read-through transcription occurs between the upstream gene NPHP3 (nephronophthisis 3 (adolescent)) and this gene. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik A G 13: 58,384,389 S118P probably damaging Het
9330159F19Rik A G 10: 29,224,809 K393E possibly damaging Het
Aagab A G 9: 63,619,160 E155G probably damaging Het
Adam2 G A 14: 66,057,610 S262L probably damaging Het
Ankle2 A G 5: 110,251,675 T633A probably benign Het
Arhgef19 A G 4: 141,256,334 Y726C probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
B3galnt2 A G 13: 13,966,454 Q87R probably benign Het
Carmil1 A G 13: 24,013,407 S1349P probably benign Het
Ccdc114 A G 7: 45,941,676 K192E probably damaging Het
Cfap52 C A 11: 67,930,865 V446L probably benign Het
Cgnl1 T C 9: 71,724,663 N469D probably benign Het
Clspn ACGGCGGCGGC A 4: 126,566,437 probably null Het
Cpsf3 A G 12: 21,313,805 D632G probably benign Het
Cyp3a57 A T 5: 145,349,325 probably null Het
Dennd5a A G 7: 109,905,699 M868T probably benign Het
Dlg1 T C 16: 31,858,008 Y792H probably damaging Het
Dusp13 T A 14: 21,740,107 D57V probably damaging Het
Galnt6 A G 15: 100,697,168 V484A possibly damaging Het
Gm13128 A C 4: 144,331,668 M282L probably benign Het
Hbq1a T C 11: 32,300,214 probably null Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Igkv4-79 A G 6: 69,043,245 S29P possibly damaging Het
Lamp5 G A 2: 136,061,008 D216N probably damaging Het
Me2 A G 18: 73,781,132 F443L probably damaging Het
Ncam2 G A 16: 81,589,724 V664M probably damaging Het
Ndst4 T C 3: 125,437,905 M41T probably benign Het
Nkx6-3 G T 8: 23,153,726 A48S possibly damaging Het
Ntng2 A G 2: 29,207,535 C305R probably damaging Het
Nup210l A T 3: 90,193,054 R1462S possibly damaging Het
Olfr566 A G 7: 102,856,617 C222R probably damaging Het
Omd A T 13: 49,589,737 I88F probably benign Het
Pi4k2a G A 19: 42,115,899 A367T probably damaging Het
Prph2 T C 17: 46,910,718 F8L probably benign Het
Rasgrf2 A G 13: 91,982,855 S696P probably damaging Het
Slc26a1 T C 5: 108,673,582 D147G possibly damaging Het
Tec T C 5: 72,782,177 probably null Het
Tmem131l C A 3: 83,910,419 C1257F probably damaging Het
Trim30d C T 7: 104,472,521 G339D probably damaging Het
Ttc6 T C 12: 57,697,452 V1290A probably benign Het
Vmn1r124 A G 7: 21,260,523 V32A possibly damaging Het
Zc3h13 T A 14: 75,329,738 S921T possibly damaging Het
Other mutations in Acad11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Acad11 APN 9 104126656 missense probably damaging 1.00
IGL01100:Acad11 APN 9 104076408 missense probably damaging 0.98
IGL01920:Acad11 APN 9 104063905 critical splice donor site probably null
IGL02019:Acad11 APN 9 104115345 missense probably damaging 1.00
IGL02506:Acad11 APN 9 104091732 critical splice donor site probably null
IGL02742:Acad11 APN 9 104095625 missense probably damaging 1.00
IGL02830:Acad11 APN 9 104075919 missense probably damaging 1.00
IGL02936:Acad11 APN 9 104113512 missense probably benign 0.31
R0092:Acad11 UTSW 9 104090341 splice site probably benign
R0277:Acad11 UTSW 9 104124025 missense probably damaging 1.00
R0377:Acad11 UTSW 9 104081692 splice site probably benign
R0411:Acad11 UTSW 9 104116296 missense probably damaging 1.00
R0556:Acad11 UTSW 9 104115302 missense probably damaging 1.00
R0594:Acad11 UTSW 9 104095563 missense probably benign 0.09
R0688:Acad11 UTSW 9 104124100 missense probably damaging 1.00
R1416:Acad11 UTSW 9 104073623 missense probably damaging 0.96
R1551:Acad11 UTSW 9 104126586 missense probably damaging 0.99
R1730:Acad11 UTSW 9 104063882 missense probably benign 0.02
R1819:Acad11 UTSW 9 104114539 critical splice donor site probably null
R1884:Acad11 UTSW 9 104114485 missense probably benign 0.13
R2411:Acad11 UTSW 9 104086023 intron probably benign
R3055:Acad11 UTSW 9 104076336 missense probably damaging 0.98
R3683:Acad11 UTSW 9 104115344 missense probably damaging 1.00
R3956:Acad11 UTSW 9 104086152 intron probably benign
R4425:Acad11 UTSW 9 104073645 missense probably damaging 1.00
R4557:Acad11 UTSW 9 104082839 missense probably benign 0.00
R4701:Acad11 UTSW 9 104095565 nonsense probably null
R4764:Acad11 UTSW 9 104075877 missense probably damaging 0.99
R4872:Acad11 UTSW 9 104086266 intron probably benign
R5132:Acad11 UTSW 9 104126592 missense probably benign 0.03
R5161:Acad11 UTSW 9 104124028 missense probably benign 0.19
R5222:Acad11 UTSW 9 104097377 missense probably damaging 1.00
R5587:Acad11 UTSW 9 104063767 missense probably benign
R5683:Acad11 UTSW 9 104084283 missense probably damaging 1.00
R6512:Acad11 UTSW 9 104095559 nonsense probably null
R6815:Acad11 UTSW 9 104081327 missense probably benign 0.01
R7035:Acad11 UTSW 9 104113495 missense probably damaging 1.00
R7318:Acad11 UTSW 9 104081267 missense probably damaging 1.00
R7564:Acad11 UTSW 9 104123089 missense possibly damaging 0.94
R7673:Acad11 UTSW 9 104063906 splice site probably null
R7812:Acad11 UTSW 9 104095548 missense probably benign 0.41
R7850:Acad11 UTSW 9 104114529 missense probably damaging 1.00
R8037:Acad11 UTSW 9 104075836 missense possibly damaging 0.93
R8251:Acad11 UTSW 9 104091707 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TGCACACTTAGTCAGAGCC -3'
(R):5'- CAGCTGGGGATGAACTGTTC -3'

Sequencing Primer
(F):5'- TTAGTCAGAGCCTGCCCAC -3'
(R):5'- GGGATGAACTGTTCTGATCATCTAC -3'
Posted On2015-04-17