Incidental Mutation 'R3954:Cfap52'
ID308113
Institutional Source Beutler Lab
Gene Symbol Cfap52
Ensembl Gene ENSMUSG00000020904
Gene Namecilia and flagella associated protein 52
Synonyms4933417B11Rik, Wdr16, 1700019F09Rik
MMRRC Submission 040831-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.814) question?
Stock #R3954 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location67924806-67965651 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 67930865 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 446 (V446L)
Ref Sequence ENSEMBL: ENSMUSP00000021287 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021287]
Predicted Effect probably benign
Transcript: ENSMUST00000021287
AA Change: V446L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000021287
Gene: ENSMUSG00000020904
AA Change: V446L

DomainStartEndE-ValueType
WD40 53 97 3.71e-1 SMART
WD40 100 141 3.45e-3 SMART
WD40 149 186 1.03e1 SMART
low complexity region 262 273 N/A INTRINSIC
WD40 280 318 9.86e1 SMART
WD40 321 360 6.6e1 SMART
WD40 363 402 8.56e0 SMART
WD40 405 445 2.27e-3 SMART
WD40 450 489 3.14e-6 SMART
WD40 492 530 9.21e0 SMART
WD40 533 573 6.19e-5 SMART
WD40 576 615 2.15e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123900
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135670
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142929
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] WD repeat-containing proteins, such as WDR16, play crucial roles in a wide range of physiologic functions, including signal transduction, RNA processing, remodeling the cytoskeleton, regulation of vesicular traffic, and cell division (Silva et al., 2005 [PubMed 15967112]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik A G 13: 58,384,389 S118P probably damaging Het
9330159F19Rik A G 10: 29,224,809 K393E possibly damaging Het
Aagab A G 9: 63,619,160 E155G probably damaging Het
Acad11 A G 9: 104,086,152 probably benign Het
Adam2 G A 14: 66,057,610 S262L probably damaging Het
Ankle2 A G 5: 110,251,675 T633A probably benign Het
Arhgef19 A G 4: 141,256,334 Y726C probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
B3galnt2 A G 13: 13,966,454 Q87R probably benign Het
Carmil1 A G 13: 24,013,407 S1349P probably benign Het
Ccdc114 A G 7: 45,941,676 K192E probably damaging Het
Cgnl1 T C 9: 71,724,663 N469D probably benign Het
Clspn ACGGCGGCGGC A 4: 126,566,437 probably null Het
Cpsf3 A G 12: 21,313,805 D632G probably benign Het
Cyp3a57 A T 5: 145,349,325 probably null Het
Dennd5a A G 7: 109,905,699 M868T probably benign Het
Dlg1 T C 16: 31,858,008 Y792H probably damaging Het
Dusp13 T A 14: 21,740,107 D57V probably damaging Het
Galnt6 A G 15: 100,697,168 V484A possibly damaging Het
Gm13128 A C 4: 144,331,668 M282L probably benign Het
Hbq1a T C 11: 32,300,214 probably null Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Igkv4-79 A G 6: 69,043,245 S29P possibly damaging Het
Lamp5 G A 2: 136,061,008 D216N probably damaging Het
Me2 A G 18: 73,781,132 F443L probably damaging Het
Ncam2 G A 16: 81,589,724 V664M probably damaging Het
Ndst4 T C 3: 125,437,905 M41T probably benign Het
Nkx6-3 G T 8: 23,153,726 A48S possibly damaging Het
Ntng2 A G 2: 29,207,535 C305R probably damaging Het
Nup210l A T 3: 90,193,054 R1462S possibly damaging Het
Olfr566 A G 7: 102,856,617 C222R probably damaging Het
Omd A T 13: 49,589,737 I88F probably benign Het
Pi4k2a G A 19: 42,115,899 A367T probably damaging Het
Prph2 T C 17: 46,910,718 F8L probably benign Het
Rasgrf2 A G 13: 91,982,855 S696P probably damaging Het
Slc26a1 T C 5: 108,673,582 D147G possibly damaging Het
Tec T C 5: 72,782,177 probably null Het
Tmem131l C A 3: 83,910,419 C1257F probably damaging Het
Trim30d C T 7: 104,472,521 G339D probably damaging Het
Ttc6 T C 12: 57,697,452 V1290A probably benign Het
Vmn1r124 A G 7: 21,260,523 V32A possibly damaging Het
Zc3h13 T A 14: 75,329,738 S921T possibly damaging Het
Other mutations in Cfap52
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01758:Cfap52 APN 11 67953580 missense possibly damaging 0.67
IGL02034:Cfap52 APN 11 67946292 splice site probably null
IGL02530:Cfap52 APN 11 67954181 splice site probably benign
IGL02558:Cfap52 APN 11 67954138 missense probably benign 0.31
IGL02873:Cfap52 APN 11 67931782 missense probably damaging 1.00
IGL02887:Cfap52 APN 11 67953515 missense probably damaging 1.00
IGL02956:Cfap52 APN 11 67954075 missense probably benign
IGL03068:Cfap52 APN 11 67935856 missense probably benign 0.11
IGL03216:Cfap52 APN 11 67954106 missense possibly damaging 0.81
IGL03287:Cfap52 APN 11 67935976 unclassified probably benign
IGL03370:Cfap52 APN 11 67939055 missense probably damaging 0.98
chewbacca UTSW 11 67925125 missense possibly damaging 0.95
R0103:Cfap52 UTSW 11 67925125 missense possibly damaging 0.95
R0103:Cfap52 UTSW 11 67925125 missense possibly damaging 0.95
R0244:Cfap52 UTSW 11 67926382 missense possibly damaging 0.90
R0306:Cfap52 UTSW 11 67954070 missense probably benign
R0364:Cfap52 UTSW 11 67953610 missense possibly damaging 0.80
R0440:Cfap52 UTSW 11 67954088 missense probably benign
R0565:Cfap52 UTSW 11 67949599 missense probably benign 0.00
R1068:Cfap52 UTSW 11 67939004 missense probably benign 0.10
R1082:Cfap52 UTSW 11 67925172 missense probably damaging 0.99
R1509:Cfap52 UTSW 11 67938993 missense probably benign 0.00
R1894:Cfap52 UTSW 11 67953619 critical splice acceptor site probably null
R2994:Cfap52 UTSW 11 67939791 missense probably benign
R4611:Cfap52 UTSW 11 67926421 missense probably damaging 0.99
R4922:Cfap52 UTSW 11 67931722 critical splice donor site probably null
R5624:Cfap52 UTSW 11 67927358 missense possibly damaging 0.92
R5762:Cfap52 UTSW 11 67954121 missense possibly damaging 0.71
R5970:Cfap52 UTSW 11 67930744 missense probably damaging 1.00
R6037:Cfap52 UTSW 11 67946300 missense probably benign 0.00
R6037:Cfap52 UTSW 11 67946300 missense probably benign 0.00
R6260:Cfap52 UTSW 11 67938954 missense possibly damaging 0.85
R7401:Cfap52 UTSW 11 67949633 missense probably benign 0.02
R7580:Cfap52 UTSW 11 67946320 missense probably damaging 1.00
R7831:Cfap52 UTSW 11 67935956 missense possibly damaging 0.89
R7966:Cfap52 UTSW 11 67953745 splice site probably null
R8303:Cfap52 UTSW 11 67939795 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGAATGCTGGCAGTGTTTG -3'
(R):5'- ATTGGTAGCAGCACTCTCCAC -3'

Sequencing Primer
(F):5'- CTTTTGTATGTGTTGTGCTGTCCTCC -3'
(R):5'- CTCCACACTATTCATGGGAAGATGG -3'
Posted On2015-04-17