Incidental Mutation 'R3954:Cpsf3'
ID308114
Institutional Source Beutler Lab
Gene Symbol Cpsf3
Ensembl Gene ENSMUSG00000054309
Gene Namecleavage and polyadenylation specificity factor 3
Synonyms73 kDa
MMRRC Submission 040831-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.970) question?
Stock #R3954 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location21285391-21315056 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21313805 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 632 (D632G)
Ref Sequence ENSEMBL: ENSMUSP00000068148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067284] [ENSMUST00000076813] [ENSMUST00000221693] [ENSMUST00000223345]
Predicted Effect probably benign
Transcript: ENSMUST00000067284
AA Change: D632G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000068148
Gene: ENSMUSG00000054309
AA Change: D632G

DomainStartEndE-ValueType
Lactamase_B 24 234 8.27e-12 SMART
Beta-Casp 246 367 7.32e-45 SMART
Pfam:RMMBL 380 422 9.9e-17 PFAM
CPSF73-100_C 477 683 6.78e-81 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000076813
SMART Domains Protein: ENSMUSP00000076090
Gene: ENSMUSG00000062054

DomainStartEndE-ValueType
Pfam:Lipase_GDSL 18 213 1.3e-34 PFAM
Pfam:Lipase_GDSL_2 19 209 2.8e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220665
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220940
Predicted Effect probably benign
Transcript: ENSMUST00000221042
Predicted Effect probably benign
Transcript: ENSMUST00000221693
Predicted Effect probably benign
Transcript: ENSMUST00000222344
Predicted Effect probably benign
Transcript: ENSMUST00000223345
Meta Mutation Damage Score 0.0971 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the metallo-beta-lactamase family. The encoded protein is a 73kDa subunit of the cleavage and polyadenylation specificity factor and functions as an endonuclease that recognizes the pre-mRNA 3'-cleavage site AAUAAA prior to polyadenylation. It also cleaves after the pre-mRNA sequence ACCCA during histone 3'-end pre-mRNA processing. [provided by RefSeq, Oct 2012]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik A G 13: 58,384,389 S118P probably damaging Het
9330159F19Rik A G 10: 29,224,809 K393E possibly damaging Het
Aagab A G 9: 63,619,160 E155G probably damaging Het
Acad11 A G 9: 104,086,152 probably benign Het
Adam2 G A 14: 66,057,610 S262L probably damaging Het
Ankle2 A G 5: 110,251,675 T633A probably benign Het
Arhgef19 A G 4: 141,256,334 Y726C probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
B3galnt2 A G 13: 13,966,454 Q87R probably benign Het
Carmil1 A G 13: 24,013,407 S1349P probably benign Het
Ccdc114 A G 7: 45,941,676 K192E probably damaging Het
Cfap52 C A 11: 67,930,865 V446L probably benign Het
Cgnl1 T C 9: 71,724,663 N469D probably benign Het
Clspn ACGGCGGCGGC A 4: 126,566,437 probably null Het
Cyp3a57 A T 5: 145,349,325 probably null Het
Dennd5a A G 7: 109,905,699 M868T probably benign Het
Dlg1 T C 16: 31,858,008 Y792H probably damaging Het
Dusp13 T A 14: 21,740,107 D57V probably damaging Het
Galnt6 A G 15: 100,697,168 V484A possibly damaging Het
Gm13128 A C 4: 144,331,668 M282L probably benign Het
Hbq1a T C 11: 32,300,214 probably null Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Igkv4-79 A G 6: 69,043,245 S29P possibly damaging Het
Lamp5 G A 2: 136,061,008 D216N probably damaging Het
Me2 A G 18: 73,781,132 F443L probably damaging Het
Ncam2 G A 16: 81,589,724 V664M probably damaging Het
Ndst4 T C 3: 125,437,905 M41T probably benign Het
Nkx6-3 G T 8: 23,153,726 A48S possibly damaging Het
Ntng2 A G 2: 29,207,535 C305R probably damaging Het
Nup210l A T 3: 90,193,054 R1462S possibly damaging Het
Olfr566 A G 7: 102,856,617 C222R probably damaging Het
Omd A T 13: 49,589,737 I88F probably benign Het
Pi4k2a G A 19: 42,115,899 A367T probably damaging Het
Prph2 T C 17: 46,910,718 F8L probably benign Het
Rasgrf2 A G 13: 91,982,855 S696P probably damaging Het
Slc26a1 T C 5: 108,673,582 D147G possibly damaging Het
Tec T C 5: 72,782,177 probably null Het
Tmem131l C A 3: 83,910,419 C1257F probably damaging Het
Trim30d C T 7: 104,472,521 G339D probably damaging Het
Ttc6 T C 12: 57,697,452 V1290A probably benign Het
Vmn1r124 A G 7: 21,260,523 V32A possibly damaging Het
Zc3h13 T A 14: 75,329,738 S921T possibly damaging Het
Other mutations in Cpsf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02039:Cpsf3 APN 12 21301456 missense probably damaging 1.00
IGL02192:Cpsf3 APN 12 21310193 unclassified probably benign
IGL02192:Cpsf3 APN 12 21310196 critical splice acceptor site probably null
IGL02651:Cpsf3 APN 12 21293297 missense probably damaging 1.00
IGL02963:Cpsf3 APN 12 21302422 missense probably damaging 0.99
IGL03072:Cpsf3 APN 12 21295088 missense possibly damaging 0.83
IGL03307:Cpsf3 APN 12 21296714 missense possibly damaging 0.87
IGL03335:Cpsf3 APN 12 21306887 splice site probably null
R0419:Cpsf3 UTSW 12 21297799 missense probably damaging 1.00
R0441:Cpsf3 UTSW 12 21300084 missense probably damaging 1.00
R1669:Cpsf3 UTSW 12 21305331 missense probably damaging 1.00
R1797:Cpsf3 UTSW 12 21306850 missense probably benign 0.01
R1801:Cpsf3 UTSW 12 21313790 missense probably benign 0.01
R1860:Cpsf3 UTSW 12 21296732 missense probably damaging 1.00
R3782:Cpsf3 UTSW 12 21300066 missense possibly damaging 0.83
R3953:Cpsf3 UTSW 12 21313805 missense probably benign
R3955:Cpsf3 UTSW 12 21313805 missense probably benign
R3957:Cpsf3 UTSW 12 21313805 missense probably benign
R4922:Cpsf3 UTSW 12 21301537 missense probably damaging 1.00
R5112:Cpsf3 UTSW 12 21291784 missense probably benign
R5363:Cpsf3 UTSW 12 21308985 missense probably benign 0.00
R5507:Cpsf3 UTSW 12 21297928 missense probably damaging 1.00
R6090:Cpsf3 UTSW 12 21295193 missense probably damaging 0.99
R6144:Cpsf3 UTSW 12 21306886 splice site probably null
R6238:Cpsf3 UTSW 12 21300162 missense probably damaging 1.00
R7229:Cpsf3 UTSW 12 21296737 critical splice donor site probably null
R7974:Cpsf3 UTSW 12 21308005 missense probably damaging 1.00
R8175:Cpsf3 UTSW 12 21300177 missense probably benign 0.07
X0060:Cpsf3 UTSW 12 21302392 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AACCAGTACAGCACTCTCGTG -3'
(R):5'- AGGCTTCGTTCCACTAAGGC -3'

Sequencing Primer
(F):5'- TACAGCACTCTCGTGGGTCG -3'
(R):5'- TCGTTCCACTAAGGCACTCAC -3'
Posted On2015-04-17