Incidental Mutation 'R3954:B3galnt2'
ID308116
Institutional Source Beutler Lab
Gene Symbol B3galnt2
Ensembl Gene ENSMUSG00000039242
Gene NameUDP-GalNAc:betaGlcNAc beta 1,3-galactosaminyltransferase, polypeptide 2
SynonymsD230016N13Rik, A930105D20Rik
MMRRC Submission 040831-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3954 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location13954469-13999103 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 13966454 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 87 (Q87R)
Ref Sequence ENSEMBL: ENSMUSP00000152457 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099747] [ENSMUST00000221300] [ENSMUST00000221974] [ENSMUST00000222110] [ENSMUST00000223483]
Predicted Effect probably benign
Transcript: ENSMUST00000099747
AA Change: Q87R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000097336
Gene: ENSMUSG00000039242
AA Change: Q87R

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Galactosyl_T 300 460 2.9e-26 PFAM
low complexity region 481 492 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178096
SMART Domains Protein: ENSMUSP00000136490
Gene: ENSMUSG00000096192

DomainStartEndE-ValueType
BTB 34 145 1.76e-25 SMART
low complexity region 168 176 N/A INTRINSIC
low complexity region 184 200 N/A INTRINSIC
low complexity region 241 253 N/A INTRINSIC
ZnF_C2H2 309 328 5.12e1 SMART
ZnF_C2H2 334 356 7.26e-3 SMART
ZnF_C2H2 362 382 1.26e1 SMART
ZnF_C2H2 390 410 2.41e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221021
Predicted Effect probably benign
Transcript: ENSMUST00000221300
AA Change: Q87R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect unknown
Transcript: ENSMUST00000221333
AA Change: Q37R
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221764
Predicted Effect probably benign
Transcript: ENSMUST00000221974
AA Change: Q87R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222015
Predicted Effect probably benign
Transcript: ENSMUST00000222110
AA Change: Q87R

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223307
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223389
Predicted Effect probably benign
Transcript: ENSMUST00000223483
AA Change: Q87R

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
Meta Mutation Damage Score 0.0616 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the glycosyltransferase 31 family. The encoded protein synthesizes GalNAc:beta-1,3GlcNAc, a novel carbohydrate structure, on N- and O-glycans. Alternatively spliced transcript variants that encode different isoforms have been described. [provided by RefSeq, Mar 2013]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik A G 13: 58,384,389 S118P probably damaging Het
9330159F19Rik A G 10: 29,224,809 K393E possibly damaging Het
Aagab A G 9: 63,619,160 E155G probably damaging Het
Acad11 A G 9: 104,086,152 probably benign Het
Adam2 G A 14: 66,057,610 S262L probably damaging Het
Ankle2 A G 5: 110,251,675 T633A probably benign Het
Arhgef19 A G 4: 141,256,334 Y726C probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Carmil1 A G 13: 24,013,407 S1349P probably benign Het
Ccdc114 A G 7: 45,941,676 K192E probably damaging Het
Cfap52 C A 11: 67,930,865 V446L probably benign Het
Cgnl1 T C 9: 71,724,663 N469D probably benign Het
Clspn ACGGCGGCGGC A 4: 126,566,437 probably null Het
Cpsf3 A G 12: 21,313,805 D632G probably benign Het
Cyp3a57 A T 5: 145,349,325 probably null Het
Dennd5a A G 7: 109,905,699 M868T probably benign Het
Dlg1 T C 16: 31,858,008 Y792H probably damaging Het
Dusp13 T A 14: 21,740,107 D57V probably damaging Het
Galnt6 A G 15: 100,697,168 V484A possibly damaging Het
Gm13128 A C 4: 144,331,668 M282L probably benign Het
Hbq1a T C 11: 32,300,214 probably null Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Igkv4-79 A G 6: 69,043,245 S29P possibly damaging Het
Lamp5 G A 2: 136,061,008 D216N probably damaging Het
Me2 A G 18: 73,781,132 F443L probably damaging Het
Ncam2 G A 16: 81,589,724 V664M probably damaging Het
Ndst4 T C 3: 125,437,905 M41T probably benign Het
Nkx6-3 G T 8: 23,153,726 A48S possibly damaging Het
Ntng2 A G 2: 29,207,535 C305R probably damaging Het
Nup210l A T 3: 90,193,054 R1462S possibly damaging Het
Olfr566 A G 7: 102,856,617 C222R probably damaging Het
Omd A T 13: 49,589,737 I88F probably benign Het
Pi4k2a G A 19: 42,115,899 A367T probably damaging Het
Prph2 T C 17: 46,910,718 F8L probably benign Het
Rasgrf2 A G 13: 91,982,855 S696P probably damaging Het
Slc26a1 T C 5: 108,673,582 D147G possibly damaging Het
Tec T C 5: 72,782,177 probably null Het
Tmem131l C A 3: 83,910,419 C1257F probably damaging Het
Trim30d C T 7: 104,472,521 G339D probably damaging Het
Ttc6 T C 12: 57,697,452 V1290A probably benign Het
Vmn1r124 A G 7: 21,260,523 V32A possibly damaging Het
Zc3h13 T A 14: 75,329,738 S921T possibly damaging Het
Other mutations in B3galnt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:B3galnt2 APN 13 13987431 missense probably benign 0.15
IGL01149:B3galnt2 APN 13 13980685 missense probably benign 0.07
IGL01814:B3galnt2 APN 13 13987353 missense probably damaging 1.00
IGL02383:B3galnt2 APN 13 13997033 makesense probably null
R0106:B3galnt2 UTSW 13 13995793 missense probably benign
R0349:B3galnt2 UTSW 13 13991474 missense probably benign
R0676:B3galnt2 UTSW 13 13995793 missense probably benign
R1522:B3galnt2 UTSW 13 13970769 missense probably damaging 1.00
R1830:B3galnt2 UTSW 13 13991534 nonsense probably null
R2035:B3galnt2 UTSW 13 13966324 missense probably benign 0.10
R3686:B3galnt2 UTSW 13 13975635 critical splice donor site probably null
R5369:B3galnt2 UTSW 13 13994425 splice site probably null
R5435:B3galnt2 UTSW 13 13996990 missense probably benign 0.01
R5564:B3galnt2 UTSW 13 13995229 missense probably damaging 1.00
R5628:B3galnt2 UTSW 13 13995152 splice site probably null
R6118:B3galnt2 UTSW 13 13991509 missense probably damaging 0.96
R6396:B3galnt2 UTSW 13 13995748 missense probably damaging 1.00
R6529:B3galnt2 UTSW 13 13995792 missense probably benign 0.00
R6656:B3galnt2 UTSW 13 13975576 missense probably benign 0.00
R7345:B3galnt2 UTSW 13 13980480 splice site probably null
R7439:B3galnt2 UTSW 13 13994485 missense probably benign 0.34
R7441:B3galnt2 UTSW 13 13994485 missense probably benign 0.34
R7582:B3galnt2 UTSW 13 13991401 missense probably damaging 1.00
R7849:B3galnt2 UTSW 13 13994492 missense probably benign 0.15
R8135:B3galnt2 UTSW 13 13970869 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TACTGTAGTTGAGATGTCATGACTG -3'
(R):5'- TTCTCTGGAAGAGTCCCAGTATC -3'

Sequencing Primer
(F):5'- GGTGTGTTATCAGCTCGA -3'
(R):5'- GGAAGAGTCCCAGTATCTTTCCAC -3'
Posted On2015-04-17