Incidental Mutation 'R3954:Carmil1'
ID308117
Institutional Source Beutler Lab
Gene Symbol Carmil1
Ensembl Gene ENSMUSG00000021338
Gene Namecapping protein regulator and myosin 1 linker 1
Synonyms1110037D04Rik, Lrrc16, Lrrc16a, Carmil
MMRRC Submission 040831-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3954 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location24012344-24280795 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24013407 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1349 (S1349P)
Ref Sequence ENSEMBL: ENSMUSP00000072662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072889] [ENSMUST00000110398] [ENSMUST00000125901]
PDB Structure Solution structure of the CARMIL CAH3a/b domain bound to capping protein (CP) [SOLUTION NMR]
Crystal structure of Actin Capping Protein in complex with the Cp-binding motif derived from CARMIL [X-RAY DIFFRACTION]
Crystal structure of Actin capping protein in complex with CARMIL fragment [X-RAY DIFFRACTION]
Crystal Structure of mouse CARMIL residues 1-668 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000072889
AA Change: S1349P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000072662
Gene: ENSMUSG00000021338
AA Change: S1349P

DomainStartEndE-ValueType
low complexity region 19 37 N/A INTRINSIC
LRR 245 272 2.42e1 SMART
LRR 275 302 1.04e1 SMART
LRR 304 331 3.1e0 SMART
LRR 336 363 5.66e1 SMART
Blast:LRR 423 450 9e-8 BLAST
Blast:LRR 451 484 7e-9 BLAST
LRR 574 601 8.81e-2 SMART
Blast:LRR 602 629 6e-10 BLAST
low complexity region 745 758 N/A INTRINSIC
Pfam:CARMIL_C 790 1083 1.1e-101 PFAM
low complexity region 1131 1147 N/A INTRINSIC
low complexity region 1245 1251 N/A INTRINSIC
low complexity region 1253 1268 N/A INTRINSIC
low complexity region 1287 1296 N/A INTRINSIC
low complexity region 1317 1332 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110398
SMART Domains Protein: ENSMUSP00000106028
Gene: ENSMUSG00000021338

DomainStartEndE-ValueType
low complexity region 19 37 N/A INTRINSIC
LRR 245 272 2.42e1 SMART
LRR 275 302 1.04e1 SMART
LRR 304 331 3.1e0 SMART
LRR 336 363 5.66e1 SMART
Blast:LRR 423 450 9e-8 BLAST
LRR 451 480 3.15e1 SMART
Pfam:LRR_6 481 507 1.9e-2 PFAM
LRR 570 597 8.81e-2 SMART
Blast:LRR 598 625 6e-10 BLAST
low complexity region 741 754 N/A INTRINSIC
low complexity region 879 888 N/A INTRINSIC
PDB:3LK3|T 964 1076 1e-56 PDB
low complexity region 1127 1143 N/A INTRINSIC
low complexity region 1241 1247 N/A INTRINSIC
low complexity region 1249 1264 N/A INTRINSIC
low complexity region 1283 1292 N/A INTRINSIC
low complexity region 1313 1325 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125901
SMART Domains Protein: ENSMUSP00000126522
Gene: ENSMUSG00000021338

DomainStartEndE-ValueType
Blast:LRR 13 40 5e-8 BLAST
Blast:LRR 41 74 4e-9 BLAST
Pfam:LRR_6 75 101 4.4e-2 PFAM
Pfam:LRR_6 164 187 1.6e-3 PFAM
Blast:LRR 192 219 7e-10 BLAST
low complexity region 335 348 N/A INTRINSIC
low complexity region 473 482 N/A INTRINSIC
PDB:3LK3|T 564 676 4e-57 PDB
low complexity region 727 743 N/A INTRINSIC
low complexity region 841 847 N/A INTRINSIC
low complexity region 849 864 N/A INTRINSIC
low complexity region 883 892 N/A INTRINSIC
low complexity region 913 925 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000151566
SMART Domains Protein: ENSMUSP00000120971
Gene: ENSMUSG00000021338

DomainStartEndE-ValueType
transmembrane domain 138 160 N/A INTRINSIC
Meta Mutation Damage Score 0.0586 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (42/43)
MGI Phenotype PHENOTYPE: No abnormal phenotype was observed in a high-throughput screen, nor in a pathology assessment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik A G 13: 58,384,389 S118P probably damaging Het
9330159F19Rik A G 10: 29,224,809 K393E possibly damaging Het
Aagab A G 9: 63,619,160 E155G probably damaging Het
Acad11 A G 9: 104,086,152 probably benign Het
Adam2 G A 14: 66,057,610 S262L probably damaging Het
Ankle2 A G 5: 110,251,675 T633A probably benign Het
Arhgef19 A G 4: 141,256,334 Y726C probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
B3galnt2 A G 13: 13,966,454 Q87R probably benign Het
Ccdc114 A G 7: 45,941,676 K192E probably damaging Het
Cfap52 C A 11: 67,930,865 V446L probably benign Het
Cgnl1 T C 9: 71,724,663 N469D probably benign Het
Clspn ACGGCGGCGGC A 4: 126,566,437 probably null Het
Cpsf3 A G 12: 21,313,805 D632G probably benign Het
Cyp3a57 A T 5: 145,349,325 probably null Het
Dennd5a A G 7: 109,905,699 M868T probably benign Het
Dlg1 T C 16: 31,858,008 Y792H probably damaging Het
Dusp13 T A 14: 21,740,107 D57V probably damaging Het
Galnt6 A G 15: 100,697,168 V484A possibly damaging Het
Gm13128 A C 4: 144,331,668 M282L probably benign Het
Hbq1a T C 11: 32,300,214 probably null Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Igkv4-79 A G 6: 69,043,245 S29P possibly damaging Het
Lamp5 G A 2: 136,061,008 D216N probably damaging Het
Me2 A G 18: 73,781,132 F443L probably damaging Het
Ncam2 G A 16: 81,589,724 V664M probably damaging Het
Ndst4 T C 3: 125,437,905 M41T probably benign Het
Nkx6-3 G T 8: 23,153,726 A48S possibly damaging Het
Ntng2 A G 2: 29,207,535 C305R probably damaging Het
Nup210l A T 3: 90,193,054 R1462S possibly damaging Het
Olfr566 A G 7: 102,856,617 C222R probably damaging Het
Omd A T 13: 49,589,737 I88F probably benign Het
Pi4k2a G A 19: 42,115,899 A367T probably damaging Het
Prph2 T C 17: 46,910,718 F8L probably benign Het
Rasgrf2 A G 13: 91,982,855 S696P probably damaging Het
Slc26a1 T C 5: 108,673,582 D147G possibly damaging Het
Tec T C 5: 72,782,177 probably null Het
Tmem131l C A 3: 83,910,419 C1257F probably damaging Het
Trim30d C T 7: 104,472,521 G339D probably damaging Het
Ttc6 T C 12: 57,697,452 V1290A probably benign Het
Vmn1r124 A G 7: 21,260,523 V32A possibly damaging Het
Zc3h13 T A 14: 75,329,738 S921T possibly damaging Het
Other mutations in Carmil1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Carmil1 APN 13 24111838 missense possibly damaging 0.68
IGL00392:Carmil1 APN 13 24094491 missense probably damaging 1.00
IGL00943:Carmil1 APN 13 24111886 missense possibly damaging 0.48
IGL01375:Carmil1 APN 13 24094471 missense possibly damaging 0.88
IGL02043:Carmil1 APN 13 24024316 unclassified probably benign
IGL02122:Carmil1 APN 13 24036558 missense possibly damaging 0.95
IGL02178:Carmil1 APN 13 24094403 missense probably damaging 1.00
IGL02264:Carmil1 APN 13 24075716 missense possibly damaging 0.95
IGL02269:Carmil1 APN 13 24155410 nonsense probably null
IGL02546:Carmil1 APN 13 24115499 missense probably damaging 0.98
IGL02740:Carmil1 APN 13 24094518 missense probably damaging 0.98
IGL02876:Carmil1 APN 13 24154668 unclassified probably benign
IGL02976:Carmil1 APN 13 24092551 missense possibly damaging 0.96
IGL03012:Carmil1 APN 13 24036372 missense probably benign 0.19
IGL03107:Carmil1 APN 13 24094455 missense probably damaging 0.99
H8562:Carmil1 UTSW 13 24064647 missense probably benign 0.00
R0085:Carmil1 UTSW 13 24025867 missense probably benign
R0119:Carmil1 UTSW 13 24082020 missense probably damaging 0.98
R0166:Carmil1 UTSW 13 24099049 missense probably damaging 1.00
R0299:Carmil1 UTSW 13 24082020 missense probably damaging 0.98
R0304:Carmil1 UTSW 13 24139341 missense probably damaging 0.99
R0335:Carmil1 UTSW 13 24073983 missense probably damaging 1.00
R0369:Carmil1 UTSW 13 24082020 missense probably damaging 0.98
R0462:Carmil1 UTSW 13 24022511 missense probably benign 0.01
R1203:Carmil1 UTSW 13 24099006 missense probably damaging 1.00
R1540:Carmil1 UTSW 13 24099054 missense possibly damaging 0.92
R1730:Carmil1 UTSW 13 24041689 missense probably damaging 1.00
R1770:Carmil1 UTSW 13 24173674 missense probably damaging 1.00
R1831:Carmil1 UTSW 13 24164879 missense probably benign 0.00
R1893:Carmil1 UTSW 13 24024463 missense possibly damaging 0.72
R2099:Carmil1 UTSW 13 24173667 missense probably benign 0.00
R2153:Carmil1 UTSW 13 24141673 missense probably damaging 0.97
R2296:Carmil1 UTSW 13 24115509 missense probably damaging 1.00
R2869:Carmil1 UTSW 13 24045068 synonymous silent
R2872:Carmil1 UTSW 13 24045068 synonymous silent
R3113:Carmil1 UTSW 13 24069757 missense probably benign 0.22
R3508:Carmil1 UTSW 13 24019676 utr 3 prime probably benign
R3780:Carmil1 UTSW 13 24137169 missense probably damaging 0.99
R4027:Carmil1 UTSW 13 24067223 splice site probably benign
R4086:Carmil1 UTSW 13 24024461 missense possibly damaging 0.56
R4647:Carmil1 UTSW 13 24137179 missense probably damaging 1.00
R4792:Carmil1 UTSW 13 24067190 missense probably damaging 1.00
R4792:Carmil1 UTSW 13 24141676 missense possibly damaging 0.96
R5012:Carmil1 UTSW 13 24024420 missense possibly damaging 0.81
R5166:Carmil1 UTSW 13 24154983 critical splice donor site probably null
R5199:Carmil1 UTSW 13 24111870 missense probably damaging 1.00
R5330:Carmil1 UTSW 13 24025946 splice site probably null
R5472:Carmil1 UTSW 13 24155471 missense probably damaging 0.97
R5478:Carmil1 UTSW 13 24112045 missense probably damaging 1.00
R5496:Carmil1 UTSW 13 24155450 missense probably damaging 1.00
R5775:Carmil1 UTSW 13 24276537 missense probably benign
R5789:Carmil1 UTSW 13 24121848 missense probably damaging 1.00
R5794:Carmil1 UTSW 13 24092550 missense probably damaging 1.00
R5977:Carmil1 UTSW 13 24069736 missense probably damaging 1.00
R6127:Carmil1 UTSW 13 24036352 missense probably benign 0.03
R6128:Carmil1 UTSW 13 24013194 nonsense probably null
R6403:Carmil1 UTSW 13 24081967 missense probably damaging 1.00
R6450:Carmil1 UTSW 13 24036564 missense probably damaging 0.98
R6451:Carmil1 UTSW 13 24092558 nonsense probably null
R6684:Carmil1 UTSW 13 24022542 missense unknown
R6891:Carmil1 UTSW 13 24141723 missense probably benign 0.13
R6902:Carmil1 UTSW 13 24115545 missense possibly damaging 0.79
R6924:Carmil1 UTSW 13 24075684 nonsense probably null
R6946:Carmil1 UTSW 13 24115545 missense possibly damaging 0.79
R7038:Carmil1 UTSW 13 24139335 missense probably damaging 1.00
R7179:Carmil1 UTSW 13 24020069 missense probably benign 0.00
R7282:Carmil1 UTSW 13 24013404 missense probably benign
R7286:Carmil1 UTSW 13 24013394 missense probably damaging 0.96
R7397:Carmil1 UTSW 13 24044311 missense probably damaging 0.99
R7412:Carmil1 UTSW 13 24098810 missense possibly damaging 0.50
R7611:Carmil1 UTSW 13 24013332 missense probably benign 0.30
R7642:Carmil1 UTSW 13 24067206 missense probably benign 0.12
R7827:Carmil1 UTSW 13 24036438 missense probably benign 0.00
R7890:Carmil1 UTSW 13 24013232 missense
R8014:Carmil1 UTSW 13 24036321 missense possibly damaging 0.71
R8068:Carmil1 UTSW 13 24075728 missense probably benign 0.00
R8361:Carmil1 UTSW 13 24067130 critical splice donor site probably null
R8469:Carmil1 UTSW 13 24112028 missense probably damaging 1.00
R8558:Carmil1 UTSW 13 24025880 missense probably benign
R8698:Carmil1 UTSW 13 24036246 missense probably damaging 1.00
R8722:Carmil1 UTSW 13 24036585 missense probably benign 0.16
R8836:Carmil1 UTSW 13 24155046 missense probably damaging 1.00
X0025:Carmil1 UTSW 13 24099043 missense possibly damaging 0.47
Z1088:Carmil1 UTSW 13 24044182 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGCCCATGGAATAATTGCTGG -3'
(R):5'- TCGAAGCTTAATGCAGGTTTG -3'

Sequencing Primer
(F):5'- GGCTTTTTGTTGAAGGCATAAGAAAC -3'
(R):5'- GTTTCTGAAACAGTCCATCATGGC -3'
Posted On2015-04-17