Incidental Mutation 'R3954:Omd'
ID308118
Institutional Source Beutler Lab
Gene Symbol Omd
Ensembl Gene ENSMUSG00000048368
Gene Nameosteomodulin
Synonymsosteoadherin, OSAD, SLRR2C
MMRRC Submission 040831-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R3954 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location49582462-49592822 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 49589737 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 88 (I88F)
Ref Sequence ENSEMBL: ENSMUSP00000152066 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021818] [ENSMUST00000065494] [ENSMUST00000221170]
Predicted Effect probably benign
Transcript: ENSMUST00000021818
SMART Domains Protein: ENSMUSP00000021818
Gene: ENSMUSG00000021391

DomainStartEndE-ValueType
coiled coil region 1 34 N/A INTRINSIC
Pfam:CENP-P 102 278 3.9e-89 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000065494
AA Change: I88F

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000065706
Gene: ENSMUSG00000048368
AA Change: I88F

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LRRNT 61 95 3.14e-11 SMART
LRR 115 139 2.15e2 SMART
LRR 140 160 2.2e1 SMART
LRR 162 184 4.21e1 SMART
LRR 185 210 1.01e2 SMART
LRR 211 234 6.96e0 SMART
LRR 235 255 8.49e1 SMART
LRR 256 279 1.76e-1 SMART
LRR 300 322 7.8e1 SMART
Blast:LRR 330 353 6e-8 BLAST
low complexity region 385 391 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000221170
AA Change: I88F

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221751
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (42/43)
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in impaired cued contextual conditioning behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik A G 13: 58,384,389 S118P probably damaging Het
9330159F19Rik A G 10: 29,224,809 K393E possibly damaging Het
Aagab A G 9: 63,619,160 E155G probably damaging Het
Acad11 A G 9: 104,086,152 probably benign Het
Adam2 G A 14: 66,057,610 S262L probably damaging Het
Ankle2 A G 5: 110,251,675 T633A probably benign Het
Arhgef19 A G 4: 141,256,334 Y726C probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
B3galnt2 A G 13: 13,966,454 Q87R probably benign Het
Carmil1 A G 13: 24,013,407 S1349P probably benign Het
Ccdc114 A G 7: 45,941,676 K192E probably damaging Het
Cfap52 C A 11: 67,930,865 V446L probably benign Het
Cgnl1 T C 9: 71,724,663 N469D probably benign Het
Clspn ACGGCGGCGGC A 4: 126,566,437 probably null Het
Cpsf3 A G 12: 21,313,805 D632G probably benign Het
Cyp3a57 A T 5: 145,349,325 probably null Het
Dennd5a A G 7: 109,905,699 M868T probably benign Het
Dlg1 T C 16: 31,858,008 Y792H probably damaging Het
Dusp13 T A 14: 21,740,107 D57V probably damaging Het
Galnt6 A G 15: 100,697,168 V484A possibly damaging Het
Gm13128 A C 4: 144,331,668 M282L probably benign Het
Hbq1a T C 11: 32,300,214 probably null Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Igkv4-79 A G 6: 69,043,245 S29P possibly damaging Het
Lamp5 G A 2: 136,061,008 D216N probably damaging Het
Me2 A G 18: 73,781,132 F443L probably damaging Het
Ncam2 G A 16: 81,589,724 V664M probably damaging Het
Ndst4 T C 3: 125,437,905 M41T probably benign Het
Nkx6-3 G T 8: 23,153,726 A48S possibly damaging Het
Ntng2 A G 2: 29,207,535 C305R probably damaging Het
Nup210l A T 3: 90,193,054 R1462S possibly damaging Het
Olfr566 A G 7: 102,856,617 C222R probably damaging Het
Pi4k2a G A 19: 42,115,899 A367T probably damaging Het
Prph2 T C 17: 46,910,718 F8L probably benign Het
Rasgrf2 A G 13: 91,982,855 S696P probably damaging Het
Slc26a1 T C 5: 108,673,582 D147G possibly damaging Het
Tec T C 5: 72,782,177 probably null Het
Tmem131l C A 3: 83,910,419 C1257F probably damaging Het
Trim30d C T 7: 104,472,521 G339D probably damaging Het
Ttc6 T C 12: 57,697,452 V1290A probably benign Het
Vmn1r124 A G 7: 21,260,523 V32A possibly damaging Het
Zc3h13 T A 14: 75,329,738 S921T possibly damaging Het
Other mutations in Omd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01976:Omd APN 13 49589643 nonsense probably null
IGL01982:Omd APN 13 49589497 missense possibly damaging 0.88
IGL02678:Omd APN 13 49592281 missense probably benign 0.37
IGL03069:Omd APN 13 49592394 utr 3 prime probably benign
R1036:Omd UTSW 13 49589971 missense probably damaging 1.00
R4030:Omd UTSW 13 49589649 missense probably benign 0.08
R4335:Omd UTSW 13 49590236 missense probably benign 0.02
R5095:Omd UTSW 13 49589698 missense possibly damaging 0.95
R5137:Omd UTSW 13 49590076 missense probably benign 0.05
R5400:Omd UTSW 13 49592227 missense probably benign 0.37
R5596:Omd UTSW 13 49592338 missense probably benign 0.16
R5930:Omd UTSW 13 49589636 missense possibly damaging 0.63
R6132:Omd UTSW 13 49590367 missense probably damaging 0.97
R6294:Omd UTSW 13 49589991 missense probably damaging 1.00
R6454:Omd UTSW 13 49589869 missense probably damaging 0.99
R6680:Omd UTSW 13 49589528 missense possibly damaging 0.74
R6704:Omd UTSW 13 49589873 missense probably damaging 1.00
R6932:Omd UTSW 13 49590234 missense probably damaging 1.00
R7427:Omd UTSW 13 49592269 missense possibly damaging 0.68
R7884:Omd UTSW 13 49590154 missense probably damaging 1.00
R7971:Omd UTSW 13 49590254 missense probably benign 0.00
R8129:Omd UTSW 13 49592089 missense probably damaging 0.99
R8399:Omd UTSW 13 49589869 missense possibly damaging 0.50
R8914:Omd UTSW 13 49592242 missense probably damaging 1.00
R8959:Omd UTSW 13 49592314 missense possibly damaging 0.57
Predicted Primers PCR Primer
(F):5'- GACGATTATGACCAAGAGCCAAATG -3'
(R):5'- CCCGTCCATGGCATTTGTTG -3'

Sequencing Primer
(F):5'- CCAAGAGCCAAATGAGGATTATGATC -3'
(R):5'- CATTATAACCAAGAAGGAGTCTTTCC -3'
Posted On2015-04-17