Incidental Mutation 'R3954:2210016F16Rik'
ID308119
Institutional Source Beutler Lab
Gene Symbol 2210016F16Rik
Ensembl Gene ENSMUSG00000021550
Gene NameRIKEN cDNA 2210016F16 gene
Synonyms
MMRRC Submission 040831-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.184) question?
Stock #R3954 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location58379817-58385225 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58384389 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 118 (S118P)
Ref Sequence ENSEMBL: ENSMUSP00000022032 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022032]
Predicted Effect probably damaging
Transcript: ENSMUST00000022032
AA Change: S118P

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000022032
Gene: ENSMUSG00000021550
AA Change: S118P

DomainStartEndE-ValueType
low complexity region 31 41 N/A INTRINSIC
Pfam:Q_salvage 53 338 9.7e-122 PFAM
Meta Mutation Damage Score 0.1977 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (42/43)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik A G 10: 29,224,809 K393E possibly damaging Het
Aagab A G 9: 63,619,160 E155G probably damaging Het
Acad11 A G 9: 104,086,152 probably benign Het
Adam2 G A 14: 66,057,610 S262L probably damaging Het
Ankle2 A G 5: 110,251,675 T633A probably benign Het
Arhgef19 A G 4: 141,256,334 Y726C probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
B3galnt2 A G 13: 13,966,454 Q87R probably benign Het
Carmil1 A G 13: 24,013,407 S1349P probably benign Het
Ccdc114 A G 7: 45,941,676 K192E probably damaging Het
Cfap52 C A 11: 67,930,865 V446L probably benign Het
Cgnl1 T C 9: 71,724,663 N469D probably benign Het
Clspn ACGGCGGCGGC A 4: 126,566,437 probably null Het
Cpsf3 A G 12: 21,313,805 D632G probably benign Het
Cyp3a57 A T 5: 145,349,325 probably null Het
Dennd5a A G 7: 109,905,699 M868T probably benign Het
Dlg1 T C 16: 31,858,008 Y792H probably damaging Het
Dusp13 T A 14: 21,740,107 D57V probably damaging Het
Galnt6 A G 15: 100,697,168 V484A possibly damaging Het
Gm13128 A C 4: 144,331,668 M282L probably benign Het
Hbq1a T C 11: 32,300,214 probably null Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Igkv4-79 A G 6: 69,043,245 S29P possibly damaging Het
Lamp5 G A 2: 136,061,008 D216N probably damaging Het
Me2 A G 18: 73,781,132 F443L probably damaging Het
Ncam2 G A 16: 81,589,724 V664M probably damaging Het
Ndst4 T C 3: 125,437,905 M41T probably benign Het
Nkx6-3 G T 8: 23,153,726 A48S possibly damaging Het
Ntng2 A G 2: 29,207,535 C305R probably damaging Het
Nup210l A T 3: 90,193,054 R1462S possibly damaging Het
Olfr566 A G 7: 102,856,617 C222R probably damaging Het
Omd A T 13: 49,589,737 I88F probably benign Het
Pi4k2a G A 19: 42,115,899 A367T probably damaging Het
Prph2 T C 17: 46,910,718 F8L probably benign Het
Rasgrf2 A G 13: 91,982,855 S696P probably damaging Het
Slc26a1 T C 5: 108,673,582 D147G possibly damaging Het
Tec T C 5: 72,782,177 probably null Het
Tmem131l C A 3: 83,910,419 C1257F probably damaging Het
Trim30d C T 7: 104,472,521 G339D probably damaging Het
Ttc6 T C 12: 57,697,452 V1290A probably benign Het
Vmn1r124 A G 7: 21,260,523 V32A possibly damaging Het
Zc3h13 T A 14: 75,329,738 S921T possibly damaging Het
Other mutations in 2210016F16Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01160:2210016F16Rik APN 13 58381976 missense probably damaging 1.00
IGL02302:2210016F16Rik APN 13 58381935 missense probably damaging 1.00
PIT1430001:2210016F16Rik UTSW 13 58385013 nonsense probably null
R0055:2210016F16Rik UTSW 13 58384166 missense probably damaging 1.00
R0055:2210016F16Rik UTSW 13 58384166 missense probably damaging 1.00
R2874:2210016F16Rik UTSW 13 58382570 missense probably damaging 1.00
R3956:2210016F16Rik UTSW 13 58384389 missense probably damaging 0.97
R4012:2210016F16Rik UTSW 13 58381986 nonsense probably null
R4212:2210016F16Rik UTSW 13 58381991 missense probably damaging 1.00
R4469:2210016F16Rik UTSW 13 58382425 missense probably damaging 1.00
R4712:2210016F16Rik UTSW 13 58381803 missense probably benign 0.06
R5401:2210016F16Rik UTSW 13 58382591 missense probably benign
R6876:2210016F16Rik UTSW 13 58385096 missense probably damaging 1.00
R6957:2210016F16Rik UTSW 13 58381961 missense probably damaging 1.00
R7285:2210016F16Rik UTSW 13 58384385 missense probably damaging 1.00
R7599:2210016F16Rik UTSW 13 58381835 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTGCATTAACTTCTGCGCAC -3'
(R):5'- GTCCGGACATACAGAAGCAATG -3'

Sequencing Primer
(F):5'- GCATTAACTTCTGCGCACTTCTG -3'
(R):5'- CAGGCAGAGTAGTCCTGTTCAG -3'
Posted On2015-04-17