Incidental Mutation 'R3954:Dusp13'
ID308121
Institutional Source Beutler Lab
Gene Symbol Dusp13
Ensembl Gene ENSMUSG00000021768
Gene Namedual specificity phosphatase 13
SynonymsTMDP, TS-DSP6, LMW-DSP6, LOC382853
MMRRC Submission 040831-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3954 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location21733394-21751181 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 21740107 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 57 (D57V)
Ref Sequence ENSEMBL: ENSMUSP00000138972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075040] [ENSMUST00000119866] [ENSMUST00000120956] [ENSMUST00000120984] [ENSMUST00000127851] [ENSMUST00000153071] [ENSMUST00000183698] [ENSMUST00000183893] [ENSMUST00000183943] [ENSMUST00000184703] [ENSMUST00000184571] [ENSMUST00000185042]
Predicted Effect probably benign
Transcript: ENSMUST00000075040
SMART Domains Protein: ENSMUSP00000074553
Gene: ENSMUSG00000021768

DomainStartEndE-ValueType
DSPc 37 181 7.66e-32 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119866
AA Change: D175V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112552
Gene: ENSMUSG00000021768
AA Change: D175V

DomainStartEndE-ValueType
DSPc 45 190 9.29e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120956
AA Change: D122V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113305
Gene: ENSMUSG00000021768
AA Change: D122V

DomainStartEndE-ValueType
DSPc 110 255 9.29e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120984
AA Change: D57V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113985
Gene: ENSMUSG00000021768
AA Change: D57V

DomainStartEndE-ValueType
DSPc 45 190 9.29e-31 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127051
SMART Domains Protein: ENSMUSP00000127910
Gene: ENSMUSG00000021768

DomainStartEndE-ValueType
DSPc 9 142 2.4e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127851
SMART Domains Protein: ENSMUSP00000120977
Gene: ENSMUSG00000021768

DomainStartEndE-ValueType
SCOP:d1vhra_ 20 133 9e-10 SMART
Blast:DSPc 37 129 5e-60 BLAST
PDB:2E0T|A 39 129 1e-26 PDB
low complexity region 162 173 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141004
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141656
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142076
Predicted Effect probably benign
Transcript: ENSMUST00000153071
SMART Domains Protein: ENSMUSP00000139140
Gene: ENSMUSG00000021768

DomainStartEndE-ValueType
Pfam:DSPc 1 48 5.2e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000183698
AA Change: D80V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139058
Gene: ENSMUSG00000021768
AA Change: D80V

DomainStartEndE-ValueType
DSPc 68 213 9.29e-31 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183824
Predicted Effect probably benign
Transcript: ENSMUST00000183893
SMART Domains Protein: ENSMUSP00000139061
Gene: ENSMUSG00000021768

DomainStartEndE-ValueType
low complexity region 50 67 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000183943
AA Change: D107V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139154
Gene: ENSMUSG00000021768
AA Change: D107V

DomainStartEndE-ValueType
internal_repeat_1 19 71 6.78e-8 PROSPERO
DSPc 95 240 9.29e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000184703
AA Change: D57V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138972
Gene: ENSMUSG00000021768
AA Change: D57V

DomainStartEndE-ValueType
DSPc 45 190 9.29e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184571
Predicted Effect probably benign
Transcript: ENSMUST00000185042
Meta Mutation Damage Score 0.4399 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: Members of the protein-tyrosine phosphatase superfamily cooperate with protein kinases to regulate cell proliferation and differentiation. This superfamily is separated into two families based on the substrate that is dephosphorylated. One family, the dual specificity phosphatases (DSPs) acts on both phosphotyrosine and phosphoserine/threonine residues. This gene encodes different but related DSP proteins through the use of non-overlapping open reading frames, alternate splicing, and presumed different transcription promoters. Expression of the distinct proteins from this gene has been found to be tissue specific and the proteins may be involved in postnatal development of specific tissues. A protein encoded by the upstream ORF was found in skeletal muscle, whereas the encoded protein from the downstream ORF was found only in testis. In humans, a similar pattern of expression was found. Multiple alternatively spliced transcript variants were described, but the full-length sequence of only some were determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik A G 13: 58,384,389 S118P probably damaging Het
9330159F19Rik A G 10: 29,224,809 K393E possibly damaging Het
Aagab A G 9: 63,619,160 E155G probably damaging Het
Acad11 A G 9: 104,086,152 probably benign Het
Adam2 G A 14: 66,057,610 S262L probably damaging Het
Ankle2 A G 5: 110,251,675 T633A probably benign Het
Arhgef19 A G 4: 141,256,334 Y726C probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
B3galnt2 A G 13: 13,966,454 Q87R probably benign Het
Carmil1 A G 13: 24,013,407 S1349P probably benign Het
Ccdc114 A G 7: 45,941,676 K192E probably damaging Het
Cfap52 C A 11: 67,930,865 V446L probably benign Het
Cgnl1 T C 9: 71,724,663 N469D probably benign Het
Clspn ACGGCGGCGGC A 4: 126,566,437 probably null Het
Cpsf3 A G 12: 21,313,805 D632G probably benign Het
Cyp3a57 A T 5: 145,349,325 probably null Het
Dennd5a A G 7: 109,905,699 M868T probably benign Het
Dlg1 T C 16: 31,858,008 Y792H probably damaging Het
Galnt6 A G 15: 100,697,168 V484A possibly damaging Het
Gm13128 A C 4: 144,331,668 M282L probably benign Het
Hbq1a T C 11: 32,300,214 probably null Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Igkv4-79 A G 6: 69,043,245 S29P possibly damaging Het
Lamp5 G A 2: 136,061,008 D216N probably damaging Het
Me2 A G 18: 73,781,132 F443L probably damaging Het
Ncam2 G A 16: 81,589,724 V664M probably damaging Het
Ndst4 T C 3: 125,437,905 M41T probably benign Het
Nkx6-3 G T 8: 23,153,726 A48S possibly damaging Het
Ntng2 A G 2: 29,207,535 C305R probably damaging Het
Nup210l A T 3: 90,193,054 R1462S possibly damaging Het
Olfr566 A G 7: 102,856,617 C222R probably damaging Het
Omd A T 13: 49,589,737 I88F probably benign Het
Pi4k2a G A 19: 42,115,899 A367T probably damaging Het
Prph2 T C 17: 46,910,718 F8L probably benign Het
Rasgrf2 A G 13: 91,982,855 S696P probably damaging Het
Slc26a1 T C 5: 108,673,582 D147G possibly damaging Het
Tec T C 5: 72,782,177 probably null Het
Tmem131l C A 3: 83,910,419 C1257F probably damaging Het
Trim30d C T 7: 104,472,521 G339D probably damaging Het
Ttc6 T C 12: 57,697,452 V1290A probably benign Het
Vmn1r124 A G 7: 21,260,523 V32A possibly damaging Het
Zc3h13 T A 14: 75,329,738 S921T possibly damaging Het
Other mutations in Dusp13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01803:Dusp13 APN 14 21733839 missense probably damaging 1.00
IGL02963:Dusp13 APN 14 21733807 missense possibly damaging 0.86
R0827:Dusp13 UTSW 14 21742771 missense probably benign
R1185:Dusp13 UTSW 14 21735018 missense probably damaging 1.00
R1185:Dusp13 UTSW 14 21735018 missense probably damaging 1.00
R1185:Dusp13 UTSW 14 21735018 missense probably damaging 1.00
R1882:Dusp13 UTSW 14 21734975 missense probably benign 0.04
R2915:Dusp13 UTSW 14 21740137 missense probably damaging 1.00
R4623:Dusp13 UTSW 14 21743478 unclassified probably benign
R4837:Dusp13 UTSW 14 21743525 utr 3 prime probably benign
R6713:Dusp13 UTSW 14 21748473 missense probably damaging 1.00
R7294:Dusp13 UTSW 14 21733714 missense possibly damaging 0.47
R7782:Dusp13 UTSW 14 21741336 missense possibly damaging 0.86
R8088:Dusp13 UTSW 14 21741237 missense probably benign 0.33
R8176:Dusp13 UTSW 14 21747481 missense possibly damaging 0.81
R8227:Dusp13 UTSW 14 21742801 missense probably benign
R8520:Dusp13 UTSW 14 21743470 nonsense probably null
R8724:Dusp13 UTSW 14 21746407 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ACAGGTCACTTCTAGGATACAAGG -3'
(R):5'- AGCCTGTTCCAGCTACTGTC -3'

Sequencing Primer
(F):5'- GAATTCTCTATTCCATGGCCTGAAAG -3'
(R):5'- ACTCTGTTCCCAGAATGGACTCG -3'
Posted On2015-04-17