Incidental Mutation 'R3954:Prph2'
ID308128
Institutional Source Beutler Lab
Gene Symbol Prph2
Ensembl Gene ENSMUSG00000023978
Gene Nameperipherin 2
SynonymsNmf193, Rd2, rds, Tspan22
MMRRC Submission 040831-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3954 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location46910459-46924933 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46910718 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 8 (F8L)
Ref Sequence ENSEMBL: ENSMUSP00000024773 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024773]
Predicted Effect probably benign
Transcript: ENSMUST00000024773
AA Change: F8L

PolyPhen 2 Score 0.389 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000024773
Gene: ENSMUSG00000023978
AA Change: F8L

DomainStartEndE-ValueType
Pfam:Tetraspannin 16 288 2.2e-28 PFAM
low complexity region 333 346 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162469
Meta Mutation Damage Score 0.0913 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein is a cell surface glycoprotein found in the outer segment of both rod and cone photoreceptor cells. It may function as an adhesion molecule involved in stabilization and compaction of outer segment disks or in the maintenance of the curvature of the rim. This protein is essential for disk morphogenesis. Defects in this gene are associated with both central and peripheral retinal degenerations. Some of the various phenotypically different disorders are autosomal dominant retinitis pigmentosa, progressive macular degeneration, macular dystrophy and retinitis pigmentosa digenic. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous mutation display slow retinal degeneration with thinning and loss of the outer nuclear layer, loss of photoreceptor outer segments, and increased numbers of Muller cells. Heterozygous mice also display retinal degeneration and Muller cell gliosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik A G 13: 58,384,389 S118P probably damaging Het
9330159F19Rik A G 10: 29,224,809 K393E possibly damaging Het
Aagab A G 9: 63,619,160 E155G probably damaging Het
Acad11 A G 9: 104,086,152 probably benign Het
Adam2 G A 14: 66,057,610 S262L probably damaging Het
Ankle2 A G 5: 110,251,675 T633A probably benign Het
Arhgef19 A G 4: 141,256,334 Y726C probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
B3galnt2 A G 13: 13,966,454 Q87R probably benign Het
Carmil1 A G 13: 24,013,407 S1349P probably benign Het
Ccdc114 A G 7: 45,941,676 K192E probably damaging Het
Cfap52 C A 11: 67,930,865 V446L probably benign Het
Cgnl1 T C 9: 71,724,663 N469D probably benign Het
Clspn ACGGCGGCGGC A 4: 126,566,437 probably null Het
Cpsf3 A G 12: 21,313,805 D632G probably benign Het
Cyp3a57 A T 5: 145,349,325 probably null Het
Dennd5a A G 7: 109,905,699 M868T probably benign Het
Dlg1 T C 16: 31,858,008 Y792H probably damaging Het
Dusp13 T A 14: 21,740,107 D57V probably damaging Het
Galnt6 A G 15: 100,697,168 V484A possibly damaging Het
Gm13128 A C 4: 144,331,668 M282L probably benign Het
Hbq1a T C 11: 32,300,214 probably null Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Igkv4-79 A G 6: 69,043,245 S29P possibly damaging Het
Lamp5 G A 2: 136,061,008 D216N probably damaging Het
Me2 A G 18: 73,781,132 F443L probably damaging Het
Ncam2 G A 16: 81,589,724 V664M probably damaging Het
Ndst4 T C 3: 125,437,905 M41T probably benign Het
Nkx6-3 G T 8: 23,153,726 A48S possibly damaging Het
Ntng2 A G 2: 29,207,535 C305R probably damaging Het
Nup210l A T 3: 90,193,054 R1462S possibly damaging Het
Olfr566 A G 7: 102,856,617 C222R probably damaging Het
Omd A T 13: 49,589,737 I88F probably benign Het
Pi4k2a G A 19: 42,115,899 A367T probably damaging Het
Rasgrf2 A G 13: 91,982,855 S696P probably damaging Het
Slc26a1 T C 5: 108,673,582 D147G possibly damaging Het
Tec T C 5: 72,782,177 probably null Het
Tmem131l C A 3: 83,910,419 C1257F probably damaging Het
Trim30d C T 7: 104,472,521 G339D probably damaging Het
Ttc6 T C 12: 57,697,452 V1290A probably benign Het
Vmn1r124 A G 7: 21,260,523 V32A possibly damaging Het
Zc3h13 T A 14: 75,329,738 S921T possibly damaging Het
Other mutations in Prph2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Prph2 APN 17 46919778 missense probably damaging 0.97
IGL01087:Prph2 APN 17 46911159 missense probably damaging 0.97
PIT4480001:Prph2 UTSW 17 46911113 frame shift probably null
R0025:Prph2 UTSW 17 46919771 missense probably benign 0.17
R2235:Prph2 UTSW 17 46911166 missense probably damaging 1.00
R3120:Prph2 UTSW 17 46923372 missense possibly damaging 0.49
R4864:Prph2 UTSW 17 46910922 missense probably benign 0.03
R4972:Prph2 UTSW 17 46910807 missense possibly damaging 0.94
R5645:Prph2 UTSW 17 46910667 start gained probably benign
R5687:Prph2 UTSW 17 46923465 missense probably damaging 0.99
R6494:Prph2 UTSW 17 46911081 missense probably benign 0.03
R6658:Prph2 UTSW 17 46919864 missense probably benign 0.05
R7775:Prph2 UTSW 17 46910806 missense possibly damaging 0.82
R7778:Prph2 UTSW 17 46910806 missense possibly damaging 0.82
R7824:Prph2 UTSW 17 46910806 missense possibly damaging 0.82
R8098:Prph2 UTSW 17 46919966 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GTTAACGGGGATCCCAAGCTAG -3'
(R):5'- TCTTCCCAGCCAGAGAGTTG -3'

Sequencing Primer
(F):5'- CCAAGCTAGGGAGGCCC -3'
(R):5'- TTCCCAGCCAGAGAGTTGAAGAC -3'
Posted On2015-04-17