Incidental Mutation 'R3954:Pi4k2a'
ID308132
Institutional Source Beutler Lab
Gene Symbol Pi4k2a
Ensembl Gene ENSMUSG00000025178
Gene Namephosphatidylinositol 4-kinase type 2 alpha
Synonyms
MMRRC Submission 040831-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.920) question?
Stock #R3954 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location42090435-42122218 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 42115899 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 367 (A367T)
Ref Sequence ENSEMBL: ENSMUSP00000069284 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066778]
Predicted Effect probably damaging
Transcript: ENSMUST00000066778
AA Change: A367T

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000069284
Gene: ENSMUSG00000025178
AA Change: A367T

DomainStartEndE-ValueType
low complexity region 31 53 N/A INTRINSIC
low complexity region 68 98 N/A INTRINSIC
Pfam:PI3_PI4_kinase 133 431 1.7e-67 PFAM
Meta Mutation Damage Score 0.2462 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphatidylinositolpolyphosphates (PtdInsPs) are centrally involved in many biologic processes, ranging from cell growth and organization of the actin cytoskeleton to endo- and exocytosis. PI4KII phosphorylates PtdIns at the D-4 position, an essential step in the biosynthesis of PtdInsPs (Barylko et al., 2001 [PubMed 11244087]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trap allele develop a progressive neurologic disease typified by urinary incontinence, tremor, limb weakness, weight loss, cerebellar gliosis, Purkinje cell loss, degeneration of spinal cord axons and premature death. Mutant males are sterile while females are subfertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik A G 13: 58,384,389 S118P probably damaging Het
9330159F19Rik A G 10: 29,224,809 K393E possibly damaging Het
Aagab A G 9: 63,619,160 E155G probably damaging Het
Acad11 A G 9: 104,086,152 probably benign Het
Adam2 G A 14: 66,057,610 S262L probably damaging Het
Ankle2 A G 5: 110,251,675 T633A probably benign Het
Arhgef19 A G 4: 141,256,334 Y726C probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
B3galnt2 A G 13: 13,966,454 Q87R probably benign Het
Carmil1 A G 13: 24,013,407 S1349P probably benign Het
Ccdc114 A G 7: 45,941,676 K192E probably damaging Het
Cfap52 C A 11: 67,930,865 V446L probably benign Het
Cgnl1 T C 9: 71,724,663 N469D probably benign Het
Clspn ACGGCGGCGGC A 4: 126,566,437 probably null Het
Cpsf3 A G 12: 21,313,805 D632G probably benign Het
Cyp3a57 A T 5: 145,349,325 probably null Het
Dennd5a A G 7: 109,905,699 M868T probably benign Het
Dlg1 T C 16: 31,858,008 Y792H probably damaging Het
Dusp13 T A 14: 21,740,107 D57V probably damaging Het
Galnt6 A G 15: 100,697,168 V484A possibly damaging Het
Gm13128 A C 4: 144,331,668 M282L probably benign Het
Hbq1a T C 11: 32,300,214 probably null Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Igkv4-79 A G 6: 69,043,245 S29P possibly damaging Het
Lamp5 G A 2: 136,061,008 D216N probably damaging Het
Me2 A G 18: 73,781,132 F443L probably damaging Het
Ncam2 G A 16: 81,589,724 V664M probably damaging Het
Ndst4 T C 3: 125,437,905 M41T probably benign Het
Nkx6-3 G T 8: 23,153,726 A48S possibly damaging Het
Ntng2 A G 2: 29,207,535 C305R probably damaging Het
Nup210l A T 3: 90,193,054 R1462S possibly damaging Het
Olfr566 A G 7: 102,856,617 C222R probably damaging Het
Omd A T 13: 49,589,737 I88F probably benign Het
Prph2 T C 17: 46,910,718 F8L probably benign Het
Rasgrf2 A G 13: 91,982,855 S696P probably damaging Het
Slc26a1 T C 5: 108,673,582 D147G possibly damaging Het
Tec T C 5: 72,782,177 probably null Het
Tmem131l C A 3: 83,910,419 C1257F probably damaging Het
Trim30d C T 7: 104,472,521 G339D probably damaging Het
Ttc6 T C 12: 57,697,452 V1290A probably benign Het
Vmn1r124 A G 7: 21,260,523 V32A possibly damaging Het
Zc3h13 T A 14: 75,329,738 S921T possibly damaging Het
Other mutations in Pi4k2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01710:Pi4k2a APN 19 42104979 missense probably damaging 1.00
IGL02959:Pi4k2a APN 19 42113071 missense probably benign 0.42
R1570:Pi4k2a UTSW 19 42100644 missense probably benign 0.33
R1992:Pi4k2a UTSW 19 42115938 missense probably damaging 1.00
R2113:Pi4k2a UTSW 19 42115071 missense possibly damaging 0.78
R2358:Pi4k2a UTSW 19 42090692 missense probably damaging 0.99
R2410:Pi4k2a UTSW 19 42104877 missense possibly damaging 0.55
R3547:Pi4k2a UTSW 19 42090548 missense probably benign 0.10
R3708:Pi4k2a UTSW 19 42090931 nonsense probably null
R3712:Pi4k2a UTSW 19 42090692 missense probably damaging 0.99
R4654:Pi4k2a UTSW 19 42113105 critical splice donor site probably null
R5077:Pi4k2a UTSW 19 42119836 splice site probably null
R5386:Pi4k2a UTSW 19 42090515 missense probably damaging 0.99
R5846:Pi4k2a UTSW 19 42115038 missense probably benign 0.01
R5867:Pi4k2a UTSW 19 42105485 critical splice donor site probably null
R5878:Pi4k2a UTSW 19 42100641 missense probably benign 0.02
R6502:Pi4k2a UTSW 19 42090932 missense probably benign 0.04
R7042:Pi4k2a UTSW 19 42104898 missense probably benign 0.18
R7269:Pi4k2a UTSW 19 42090686 missense probably damaging 1.00
R7819:Pi4k2a UTSW 19 42090574 missense probably benign
R8249:Pi4k2a UTSW 19 42115062 missense probably benign 0.00
R8560:Pi4k2a UTSW 19 42100712 nonsense probably null
Z1177:Pi4k2a UTSW 19 42104925 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTCACCTGGGAAAGAACTCTG -3'
(R):5'- ACTTCTTGACTTGTGCCAGG -3'

Sequencing Primer
(F):5'- AACTCTGAGATCAGGCAGTTCTG -3'
(R):5'- CTTCTTGACTTGTGCCAGGACAAAG -3'
Posted On2015-04-17