Incidental Mutation 'R1888:Mpped2'
ID308142
Institutional Source Beutler Lab
Gene Symbol Mpped2
Ensembl Gene ENSMUSG00000016386
Gene Namemetallophosphoesterase domain containing 2
Synonyms239Fb, 2700082O15Rik
MMRRC Submission 039909-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1888 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location106693269-106868356 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106699445 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 13 (I13T)
Ref Sequence ENSEMBL: ENSMUSP00000123267 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016530] [ENSMUST00000111063] [ENSMUST00000125023] [ENSMUST00000144155]
Predicted Effect probably benign
Transcript: ENSMUST00000016530
AA Change: I13T

PolyPhen 2 Score 0.140 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000016530
Gene: ENSMUSG00000016386
AA Change: I13T

DomainStartEndE-ValueType
Pfam:Metallophos 58 256 3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111063
AA Change: I13T

PolyPhen 2 Score 0.140 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000106692
Gene: ENSMUSG00000016386
AA Change: I13T

DomainStartEndE-ValueType
Pfam:Metallophos 58 256 1.5e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124461
Predicted Effect probably benign
Transcript: ENSMUST00000125023
AA Change: I13T

PolyPhen 2 Score 0.263 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000123267
Gene: ENSMUSG00000016386
AA Change: I13T

DomainStartEndE-ValueType
Pfam:Metallophos 58 256 1.7e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144155
AA Change: I13T

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000114253
Gene: ENSMUSG00000016386
AA Change: I13T

DomainStartEndE-ValueType
PDB:3RL3|A 1 67 2e-43 PDB
Meta Mutation Damage Score 0.1701 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene likely encodes a metallophosphoesterase. The encoded protein may play a role a brain development. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T C 1: 37,624,283 K845E possibly damaging Het
4930447C04Rik A G 12: 72,913,256 M80T unknown Het
4930578I06Rik A G 14: 63,986,183 L48P probably damaging Het
Abcc9 A G 6: 142,679,314 S452P probably benign Het
Adgrb2 T C 4: 130,013,626 F977S probably damaging Het
Adgrf5 T G 17: 43,427,005 probably null Het
Adgrl4 A G 3: 151,439,277 N21S probably benign Het
Adss A T 1: 177,784,951 Y77* probably null Het
Ahnak A T 19: 9,007,088 D1912V probably damaging Het
Ahnak2 A G 12: 112,773,891 M1249T possibly damaging Het
Akap6 A T 12: 53,142,175 D2124V possibly damaging Het
Ankrd28 A T 14: 31,732,025 probably benign Het
Bbs12 C A 3: 37,320,563 L387I probably damaging Het
BC023105 T C 18: 60,442,499 noncoding transcript Het
Cbwd1 A T 19: 24,955,405 V88D probably damaging Het
Ciita T C 16: 10,511,084 Y411H probably damaging Het
Ckb TCCACCACCA TCCACCA 12: 111,669,645 probably benign Het
Clec9a G A 6: 129,410,286 V35I probably benign Het
Cntn5 T A 9: 9,984,077 Q382L possibly damaging Het
Dock2 A T 11: 34,707,342 I334N probably damaging Het
Dock9 G T 14: 121,625,205 T833K probably benign Het
Drd2 G A 9: 49,402,142 V204I probably benign Het
Fam120a A T 13: 48,885,866 I938N possibly damaging Het
Fndc1 T C 17: 7,771,789 E1025G unknown Het
Fsip2 G A 2: 82,944,160 D64N probably benign Het
Gm12794 T A 4: 101,941,138 V102E probably damaging Het
Gm14496 T A 2: 182,000,196 C553* probably null Het
Gm14685 G T X: 73,127,655 G218C probably damaging Homo
Gm15587 C G 5: 24,367,469 probably benign Het
Gm1966 A T 7: 106,597,423 noncoding transcript Het
Gm6020 C T 19: 61,183,953 H22Y possibly damaging Het
Hexa A G 9: 59,557,303 T159A probably benign Het
Hmcn1 C G 1: 150,819,500 A218P possibly damaging Het
Hpgds A G 6: 65,138,233 F22S probably damaging Het
Il5ra T A 6: 106,731,913 N289Y probably damaging Het
Ilf2 T C 3: 90,487,460 probably benign Het
Irf2 A T 8: 46,807,353 R107* probably null Het
Kcnk6 T C 7: 29,225,650 I180M probably benign Het
Krtap5-3 G A 7: 142,202,242 probably benign Het
Lrig1 C T 6: 94,654,878 A114T probably benign Het
Lrrc37a A G 11: 103,498,761 V1946A probably benign Het
Lrrc8b T C 5: 105,481,351 V521A probably benign Het
Macf1 T G 4: 123,455,042 I2154L possibly damaging Het
Macf1 C A 4: 123,474,712 E2085D probably benign Het
Maml1 C T 11: 50,266,641 A236T probably benign Het
Mdc1 C A 17: 35,854,225 T1481K probably benign Het
Mecp2 C T X: 74,037,175 A79T probably damaging Homo
Med24 A G 11: 98,707,282 probably benign Het
Mfap3l T C 8: 60,671,390 V222A possibly damaging Het
Mis18bp1 A G 12: 65,149,328 I554T probably benign Het
Mthfd1l C A 10: 4,106,528 T948K probably damaging Het
Mtus1 C T 8: 41,084,325 S118N probably damaging Het
Mtx3 A G 13: 92,847,683 E156G probably benign Het
Mybbp1a C T 11: 72,446,037 T565I probably benign Het
Myh2 G A 11: 67,180,850 V498M probably damaging Het
Myo15b G A 11: 115,887,073 G1049S probably damaging Het
Myo1b T A 1: 51,760,403 probably null Het
Ndufa2 T A 18: 36,744,520 probably benign Het
Nipal2 T C 15: 34,625,021 I129M possibly damaging Het
Nt5dc3 A G 10: 86,834,062 N507S possibly damaging Het
Olfr1271 A G 2: 90,265,569 L287P probably damaging Het
Olfr875 T A 9: 37,772,867 D69E possibly damaging Het
Pcdhb17 G A 18: 37,487,385 probably null Het
Pcyt2 A G 11: 120,617,851 M1T probably null Het
Pear1 C A 3: 87,810,575 probably benign Het
Pla2g2d T C 4: 138,775,815 M1T probably null Het
Plekhg6 T C 6: 125,363,343 T685A probably damaging Het
Pxk T C 14: 8,151,540 S452P probably damaging Het
Rab42 A T 4: 132,303,218 D40E probably benign Het
Rapgef6 A C 11: 54,660,828 T836P probably damaging Het
Rtn1 A G 12: 72,236,533 probably benign Het
Serpina3a A G 12: 104,116,103 D45G probably benign Het
Slco6b1 A G 1: 96,922,061 noncoding transcript Het
Smad9 CTTT CTT 3: 54,789,179 probably benign Het
Sntb1 T A 15: 55,749,349 R278* probably null Het
Spice1 T G 16: 44,365,626 S111A probably damaging Het
Stk40 T A 4: 126,125,745 L90Q probably damaging Het
Syk A G 13: 52,640,790 Y520C probably damaging Het
Syngr2 G A 11: 117,813,398 V170M possibly damaging Het
Tcf12 A T 9: 71,858,534 D541E possibly damaging Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tlr4 T C 4: 66,841,172 V734A probably damaging Het
Tmem132a T C 19: 10,863,499 E389G probably damaging Het
Tmem150b A G 7: 4,709,045 I112T probably benign Het
Tmod1 C T 4: 46,097,069 silent Het
Trbc1 G A 6: 41,535,636 probably benign Het
Tril A G 6: 53,819,592 L215P probably damaging Het
Trim24 G T 6: 37,957,078 R652L probably damaging Het
Ttn G A 2: 76,792,807 P15429S probably damaging Het
Ttn T A 2: 76,875,958 probably benign Het
Tubgcp2 A G 7: 139,999,270 V701A probably damaging Het
Tubgcp2 A G 7: 140,006,156 F407L probably damaging Het
Usp45 T C 4: 21,784,811 probably benign Het
Vmn1r30 A C 6: 58,435,490 L119R possibly damaging Het
Washc5 A C 15: 59,359,325 L363R probably damaging Het
Zan T C 5: 137,389,328 T4874A unknown Het
Zfp420 A T 7: 29,874,508 H51L probably damaging Het
Zfp512b C A 2: 181,588,442 R497L probably damaging Het
Zmat4 A G 8: 24,015,161 N139S probably damaging Het
Other mutations in Mpped2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01068:Mpped2 APN 2 106864746 missense probably damaging 1.00
IGL01734:Mpped2 APN 2 106783813 missense probably damaging 1.00
IGL03031:Mpped2 APN 2 106783623 splice site probably benign
LCD18:Mpped2 UTSW 2 106721428 intron probably benign
R1446:Mpped2 UTSW 2 106783732 missense possibly damaging 0.92
R1460:Mpped2 UTSW 2 106744892 unclassified probably benign
R1857:Mpped2 UTSW 2 106783644 missense probably damaging 1.00
R1888:Mpped2 UTSW 2 106699445 missense probably benign 0.26
R1919:Mpped2 UTSW 2 106867032 missense probably damaging 1.00
R2073:Mpped2 UTSW 2 106744802 nonsense probably null
R2074:Mpped2 UTSW 2 106744802 nonsense probably null
R2075:Mpped2 UTSW 2 106744802 nonsense probably null
R2295:Mpped2 UTSW 2 106699501 missense possibly damaging 0.94
R4720:Mpped2 UTSW 2 106783746 missense probably damaging 1.00
R4851:Mpped2 UTSW 2 106699379 utr 5 prime probably benign
R5201:Mpped2 UTSW 2 106699502 missense possibly damaging 0.94
R6500:Mpped2 UTSW 2 106861580 missense probably damaging 1.00
R6603:Mpped2 UTSW 2 106866977 missense probably benign 0.06
R6994:Mpped2 UTSW 2 106699533 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- GGCAACGGTTATGTCCATGAGG -3'
(R):5'- TCCCTAGCAGAAGGTGGAAG -3'

Sequencing Primer
(F):5'- CTGAGCCAATTTCGTATATAGATTCC -3'
(R):5'- AAGGGAGAGTTTGCTTTCAGTTTGC -3'
Posted On2015-04-17