Incidental Mutation 'R1888:Myh2'
ID308192
Institutional Source Beutler Lab
Gene Symbol Myh2
Ensembl Gene ENSMUSG00000033196
Gene Namemyosin, heavy polypeptide 2, skeletal muscle, adult
SynonymsMHC2A, Myhs-f, Myhsf1, Myhs-f1, MyHC-IIa
MMRRC Submission 039909-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.296) question?
Stock #R1888 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location67171027-67197517 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 67180850 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 498 (V498M)
Ref Sequence ENSEMBL: ENSMUSP00000129544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018641] [ENSMUST00000170159]
Predicted Effect probably damaging
Transcript: ENSMUST00000018641
AA Change: V498M

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000018641
Gene: ENSMUSG00000033196
AA Change: V498M

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 2.1e-16 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 3.13e-3 SMART
IQ 813 835 3.14e2 SMART
low complexity region 850 862 N/A INTRINSIC
low complexity region 931 945 N/A INTRINSIC
Pfam:Myosin_tail_1 1075 1933 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170159
AA Change: V498M

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000129544
Gene: ENSMUSG00000033196
AA Change: V498M

DomainStartEndE-ValueType
Pfam:Myosin_N 35 74 1.4e-14 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 3.13e-3 SMART
IQ 813 835 3.14e2 SMART
Pfam:Myosin_tail_1 850 1931 4e-166 PFAM
Meta Mutation Damage Score 0.208 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myosins are actin-based motor proteins that function in the generation of mechanical force in eukaryotic cells. Muscle myosins are heterohexamers composed of 2 myosin heavy chains and 2 pairs of nonidentical myosin light chains. This gene encodes a member of the class II or conventional myosin heavy chains, and functions in skeletal muscle contraction. This gene is found in a cluster of myosin heavy chain genes on chromosome 17. A mutation in this gene results in inclusion body myopathy-3. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T C 1: 37,624,283 K845E possibly damaging Het
4930447C04Rik A G 12: 72,913,256 M80T unknown Het
4930578I06Rik A G 14: 63,986,183 L48P probably damaging Het
Abcc9 A G 6: 142,679,314 S452P probably benign Het
Adgrb2 T C 4: 130,013,626 F977S probably damaging Het
Adgrf5 T G 17: 43,427,005 probably null Het
Adgrl4 A G 3: 151,439,277 N21S probably benign Het
Adss A T 1: 177,784,951 Y77* probably null Het
Ahnak A T 19: 9,007,088 D1912V probably damaging Het
Ahnak2 A G 12: 112,773,891 M1249T possibly damaging Het
Akap6 A T 12: 53,142,175 D2124V possibly damaging Het
Ankrd28 A T 14: 31,732,025 probably benign Het
Bbs12 C A 3: 37,320,563 L387I probably damaging Het
BC023105 T C 18: 60,442,499 noncoding transcript Het
Cbwd1 A T 19: 24,955,405 V88D probably damaging Het
Ciita T C 16: 10,511,084 Y411H probably damaging Het
Ckb TCCACCACCA TCCACCA 12: 111,669,645 probably benign Het
Clec9a G A 6: 129,410,286 V35I probably benign Het
Cntn5 T A 9: 9,984,077 Q382L possibly damaging Het
Dock2 A T 11: 34,707,342 I334N probably damaging Het
Dock9 G T 14: 121,625,205 T833K probably benign Het
Drd2 G A 9: 49,402,142 V204I probably benign Het
Fam120a A T 13: 48,885,866 I938N possibly damaging Het
Fndc1 T C 17: 7,771,789 E1025G unknown Het
Fsip2 G A 2: 82,944,160 D64N probably benign Het
Gm12794 T A 4: 101,941,138 V102E probably damaging Het
Gm14496 T A 2: 182,000,196 C553* probably null Het
Gm14685 G T X: 73,127,655 G218C probably damaging Homo
Gm15587 C G 5: 24,367,469 probably benign Het
Gm1966 A T 7: 106,597,423 noncoding transcript Het
Gm6020 C T 19: 61,183,953 H22Y possibly damaging Het
Hexa A G 9: 59,557,303 T159A probably benign Het
Hmcn1 C G 1: 150,819,500 A218P possibly damaging Het
Hpgds A G 6: 65,138,233 F22S probably damaging Het
Il5ra T A 6: 106,731,913 N289Y probably damaging Het
Ilf2 T C 3: 90,487,460 probably benign Het
Irf2 A T 8: 46,807,353 R107* probably null Het
Kcnk6 T C 7: 29,225,650 I180M probably benign Het
Krtap5-3 G A 7: 142,202,242 probably benign Het
Lrig1 C T 6: 94,654,878 A114T probably benign Het
Lrrc37a A G 11: 103,498,761 V1946A probably benign Het
Lrrc8b T C 5: 105,481,351 V521A probably benign Het
Macf1 T G 4: 123,455,042 I2154L possibly damaging Het
Macf1 C A 4: 123,474,712 E2085D probably benign Het
Maml1 C T 11: 50,266,641 A236T probably benign Het
Mdc1 C A 17: 35,854,225 T1481K probably benign Het
Mecp2 C T X: 74,037,175 A79T probably damaging Homo
Med24 A G 11: 98,707,282 probably benign Het
Mfap3l T C 8: 60,671,390 V222A possibly damaging Het
Mis18bp1 A G 12: 65,149,328 I554T probably benign Het
Mpped2 T C 2: 106,699,445 I13T probably benign Het
Mthfd1l C A 10: 4,106,528 T948K probably damaging Het
Mtus1 C T 8: 41,084,325 S118N probably damaging Het
Mtx3 A G 13: 92,847,683 E156G probably benign Het
Mybbp1a C T 11: 72,446,037 T565I probably benign Het
Myo15b G A 11: 115,887,073 G1049S probably damaging Het
Myo1b T A 1: 51,760,403 probably null Het
Ndufa2 T A 18: 36,744,520 probably benign Het
Nipal2 T C 15: 34,625,021 I129M possibly damaging Het
Nt5dc3 A G 10: 86,834,062 N507S possibly damaging Het
Olfr1271 A G 2: 90,265,569 L287P probably damaging Het
Olfr875 T A 9: 37,772,867 D69E possibly damaging Het
Pcdhb17 G A 18: 37,487,385 probably null Het
Pcyt2 A G 11: 120,617,851 M1T probably null Het
Pear1 C A 3: 87,810,575 probably benign Het
Pla2g2d T C 4: 138,775,815 M1T probably null Het
Plekhg6 T C 6: 125,363,343 T685A probably damaging Het
Pxk T C 14: 8,151,540 S452P probably damaging Het
Rab42 A T 4: 132,303,218 D40E probably benign Het
Rapgef6 A C 11: 54,660,828 T836P probably damaging Het
Rtn1 A G 12: 72,236,533 probably benign Het
Serpina3a A G 12: 104,116,103 D45G probably benign Het
Slco6b1 A G 1: 96,922,061 noncoding transcript Het
Smad9 CTTT CTT 3: 54,789,179 probably benign Het
Sntb1 T A 15: 55,749,349 R278* probably null Het
Spice1 T G 16: 44,365,626 S111A probably damaging Het
Stk40 T A 4: 126,125,745 L90Q probably damaging Het
Syk A G 13: 52,640,790 Y520C probably damaging Het
Syngr2 G A 11: 117,813,398 V170M possibly damaging Het
Tcf12 A T 9: 71,858,534 D541E possibly damaging Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tlr4 T C 4: 66,841,172 V734A probably damaging Het
Tmem132a T C 19: 10,863,499 E389G probably damaging Het
Tmem150b A G 7: 4,709,045 I112T probably benign Het
Tmod1 C T 4: 46,097,069 silent Het
Trbc1 G A 6: 41,535,636 probably benign Het
Tril A G 6: 53,819,592 L215P probably damaging Het
Trim24 G T 6: 37,957,078 R652L probably damaging Het
Ttn G A 2: 76,792,807 P15429S probably damaging Het
Ttn T A 2: 76,875,958 probably benign Het
Tubgcp2 A G 7: 139,999,270 V701A probably damaging Het
Tubgcp2 A G 7: 140,006,156 F407L probably damaging Het
Usp45 T C 4: 21,784,811 probably benign Het
Vmn1r30 A C 6: 58,435,490 L119R possibly damaging Het
Washc5 A C 15: 59,359,325 L363R probably damaging Het
Zan T C 5: 137,389,328 T4874A unknown Het
Zfp420 A T 7: 29,874,508 H51L probably damaging Het
Zfp512b C A 2: 181,588,442 R497L probably damaging Het
Zmat4 A G 8: 24,015,161 N139S probably damaging Het
Other mutations in Myh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Myh2 APN 11 67185233 missense possibly damaging 0.88
IGL00330:Myh2 APN 11 67193440 missense probably benign 0.06
IGL00423:Myh2 APN 11 67197345 missense probably benign
IGL00429:Myh2 APN 11 67180790 nonsense probably null
IGL00465:Myh2 APN 11 67178833 splice site probably benign
IGL00671:Myh2 APN 11 67193357 missense probably damaging 0.97
IGL00773:Myh2 APN 11 67194421 missense probably benign
IGL00821:Myh2 APN 11 67197397 utr 3 prime probably benign
IGL00900:Myh2 APN 11 67179384 missense probably damaging 1.00
IGL01374:Myh2 APN 11 67177424 missense probably benign 0.05
IGL01613:Myh2 APN 11 67197344 missense probably benign 0.01
IGL01845:Myh2 APN 11 67193034 missense probably benign 0.02
IGL01900:Myh2 APN 11 67183783 missense probably benign 0.01
IGL01936:Myh2 APN 11 67191773 missense possibly damaging 0.94
IGL02129:Myh2 APN 11 67185258 missense probably benign 0.05
IGL02172:Myh2 APN 11 67189052 missense possibly damaging 0.78
IGL02554:Myh2 APN 11 67189165 missense probably benign 0.00
IGL02578:Myh2 APN 11 67186691 missense probably benign 0.33
IGL03075:Myh2 APN 11 67180836 missense probably benign 0.39
IGL03078:Myh2 APN 11 67190430 missense probably benign
IGL03117:Myh2 APN 11 67180884 missense possibly damaging 0.91
IGL03255:Myh2 APN 11 67193225 missense probably damaging 1.00
IGL03266:Myh2 APN 11 67176324 missense probably benign
IGL03366:Myh2 APN 11 67183523 missense probably damaging 1.00
IGL03412:Myh2 APN 11 67189569 missense probably benign 0.04
limp UTSW 11 67192504 missense probably damaging 1.00
noodle UTSW 11 67186612 missense probably benign
PIT4403001:Myh2 UTSW 11 67186707 missense probably benign 0.22
PIT4508001:Myh2 UTSW 11 67185505 missense probably benign 0.00
PIT4677001:Myh2 UTSW 11 67181992 missense probably benign
R0039:Myh2 UTSW 11 67178277 missense probably damaging 1.00
R0347:Myh2 UTSW 11 67185304 splice site probably benign
R0389:Myh2 UTSW 11 67180821 missense probably damaging 1.00
R0400:Myh2 UTSW 11 67192598 splice site probably benign
R0512:Myh2 UTSW 11 67188678 missense probably damaging 1.00
R0555:Myh2 UTSW 11 67178967 missense probably damaging 1.00
R0746:Myh2 UTSW 11 67173431 missense probably benign 0.00
R0842:Myh2 UTSW 11 67179524 missense possibly damaging 0.83
R0893:Myh2 UTSW 11 67186508 missense possibly damaging 0.82
R1218:Myh2 UTSW 11 67192525 missense probably damaging 0.99
R1264:Myh2 UTSW 11 67180778 missense probably damaging 0.96
R1398:Myh2 UTSW 11 67185287 missense probably benign 0.14
R1774:Myh2 UTSW 11 67173474 missense possibly damaging 0.96
R1800:Myh2 UTSW 11 67188938 missense probably damaging 0.99
R1829:Myh2 UTSW 11 67176559 missense probably damaging 0.98
R1840:Myh2 UTSW 11 67186487 missense probably benign 0.16
R1888:Myh2 UTSW 11 67180850 missense probably damaging 0.99
R1969:Myh2 UTSW 11 67189178 missense possibly damaging 0.67
R1971:Myh2 UTSW 11 67189178 missense possibly damaging 0.67
R1985:Myh2 UTSW 11 67180914 missense possibly damaging 0.65
R2021:Myh2 UTSW 11 67191719 missense probably damaging 1.00
R2029:Myh2 UTSW 11 67194625 missense possibly damaging 0.85
R2057:Myh2 UTSW 11 67188839 critical splice donor site probably null
R2080:Myh2 UTSW 11 67174941 critical splice acceptor site probably null
R2142:Myh2 UTSW 11 67189332 missense probably damaging 1.00
R2215:Myh2 UTSW 11 67191737 missense probably benign 0.35
R2225:Myh2 UTSW 11 67193729 missense probably benign
R2274:Myh2 UTSW 11 67190358 missense possibly damaging 0.84
R3018:Myh2 UTSW 11 67179584 missense possibly damaging 0.67
R3113:Myh2 UTSW 11 67185186 missense probably damaging 1.00
R3703:Myh2 UTSW 11 67189601 missense probably benign 0.01
R4022:Myh2 UTSW 11 67179404 nonsense probably null
R4081:Myh2 UTSW 11 67190430 missense probably benign 0.11
R4191:Myh2 UTSW 11 67177400 missense possibly damaging 0.81
R4291:Myh2 UTSW 11 67181159 missense probably benign 0.01
R4292:Myh2 UTSW 11 67194897 missense possibly damaging 0.46
R4424:Myh2 UTSW 11 67192725 missense probably benign 0.01
R4524:Myh2 UTSW 11 67176270 missense probably damaging 1.00
R4578:Myh2 UTSW 11 67173258 missense possibly damaging 0.85
R4597:Myh2 UTSW 11 67189418 missense probably benign 0.01
R4641:Myh2 UTSW 11 67194694 missense probably damaging 1.00
R4672:Myh2 UTSW 11 67188477 missense probably damaging 1.00
R4673:Myh2 UTSW 11 67188477 missense probably damaging 1.00
R4804:Myh2 UTSW 11 67186502 missense possibly damaging 0.78
R4818:Myh2 UTSW 11 67176255 missense probably damaging 1.00
R4943:Myh2 UTSW 11 67197317 missense probably damaging 1.00
R4958:Myh2 UTSW 11 67192959 missense possibly damaging 0.83
R5139:Myh2 UTSW 11 67179348 missense probably damaging 1.00
R5239:Myh2 UTSW 11 67192443 missense probably benign 0.00
R5306:Myh2 UTSW 11 67186556 missense probably damaging 1.00
R5492:Myh2 UTSW 11 67180875 missense probably benign 0.20
R5503:Myh2 UTSW 11 67173449 missense probably benign
R5646:Myh2 UTSW 11 67188812 missense probably benign 0.07
R5750:Myh2 UTSW 11 67191428 missense probably benign
R5806:Myh2 UTSW 11 67181315 missense probably damaging 0.98
R5878:Myh2 UTSW 11 67192504 missense probably damaging 1.00
R5892:Myh2 UTSW 11 67185176 nonsense probably null
R5898:Myh2 UTSW 11 67192719 missense possibly damaging 0.51
R6154:Myh2 UTSW 11 67186612 missense probably benign
R6156:Myh2 UTSW 11 67181053 missense probably damaging 0.98
R6236:Myh2 UTSW 11 67190331 missense probably benign 0.00
R6349:Myh2 UTSW 11 67193003 missense probably benign 0.04
R6441:Myh2 UTSW 11 67194611 missense probably benign 0.00
R6548:Myh2 UTSW 11 67186612 missense probably benign
R6681:Myh2 UTSW 11 67178348 missense probably damaging 1.00
R6907:Myh2 UTSW 11 67193741 missense probably damaging 1.00
R6925:Myh2 UTSW 11 67193218 missense probably benign 0.00
R6969:Myh2 UTSW 11 67197266 missense probably benign
R7172:Myh2 UTSW 11 67188701 missense probably benign 0.00
R7257:Myh2 UTSW 11 67181150 missense possibly damaging 0.70
R7286:Myh2 UTSW 11 67188369 missense probably benign 0.23
R7323:Myh2 UTSW 11 67197365 missense probably benign
R7396:Myh2 UTSW 11 67194728 critical splice donor site probably null
R7468:Myh2 UTSW 11 67192542 missense probably benign 0.01
X0026:Myh2 UTSW 11 67175022 missense probably benign 0.10
X0065:Myh2 UTSW 11 67176259 missense probably damaging 0.99
Z1088:Myh2 UTSW 11 67180763 critical splice acceptor site probably benign
Z1088:Myh2 UTSW 11 67191449 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTTCTGACCAGTGATGTTGACAC -3'
(R):5'- TAGGGAACATGCACTCCTCTTC -3'

Sequencing Primer
(F):5'- GACCAGTGATGTTGACACTCATCTG -3'
(R):5'- CCCATCGGCTGGTTTGAAG -3'
Posted On2015-04-17