Incidental Mutation 'R1888:Mybbp1a'
ID 308193
Institutional Source Beutler Lab
Gene Symbol Mybbp1a
Ensembl Gene ENSMUSG00000040463
Gene Name MYB binding protein (P160) 1a
Synonyms p67MBP, p160MBP
MMRRC Submission 039909-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1888 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 72332181-72342594 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 72336863 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 565 (T565I)
Ref Sequence ENSEMBL: ENSMUSP00000044827 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045633]
AlphaFold Q7TPV4
Predicted Effect probably benign
Transcript: ENSMUST00000045633
AA Change: T565I

PolyPhen 2 Score 0.181 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000044827
Gene: ENSMUSG00000040463
AA Change: T565I

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
Pfam:DNA_pol_phi 70 835 1.2e-194 PFAM
low complexity region 839 852 N/A INTRINSIC
low complexity region 1080 1090 N/A INTRINSIC
low complexity region 1109 1122 N/A INTRINSIC
low complexity region 1259 1269 N/A INTRINSIC
low complexity region 1314 1329 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134119
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144374
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144923
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152894
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155995
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156833
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162048
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleolar transcriptional regulator that was first identified by its ability to bind specifically to the Myb proto-oncogene protein. The encoded protein is thought to play a role in many cellular processes including response to nucleolar stress, tumor suppression and synthesis of ribosomal DNA. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a targeted allele exhibit embryonic lethality before blastocyst formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik A G 12: 72,960,030 (GRCm39) M80T unknown Het
4930578I06Rik A G 14: 64,223,632 (GRCm39) L48P probably damaging Het
Abcc9 A G 6: 142,625,040 (GRCm39) S452P probably benign Het
Adgrb2 T C 4: 129,907,419 (GRCm39) F977S probably damaging Het
Adgrf5 T G 17: 43,737,896 (GRCm39) probably null Het
Adgrl4 A G 3: 151,144,914 (GRCm39) N21S probably benign Het
Adss2 A T 1: 177,612,517 (GRCm39) Y77* probably null Het
Ahnak A T 19: 8,984,452 (GRCm39) D1912V probably damaging Het
Ahnak2 A G 12: 112,740,325 (GRCm39) M1249T possibly damaging Het
Akap6 A T 12: 53,188,958 (GRCm39) D2124V possibly damaging Het
Ankrd28 A T 14: 31,453,982 (GRCm39) probably benign Het
Bbs12 C A 3: 37,374,712 (GRCm39) L387I probably damaging Het
BC023105 T C 18: 60,575,571 (GRCm39) noncoding transcript Het
Ciita T C 16: 10,328,948 (GRCm39) Y411H probably damaging Het
Ckb TCCACCACCA TCCACCA 12: 111,636,079 (GRCm39) probably benign Het
Clec9a G A 6: 129,387,249 (GRCm39) V35I probably benign Het
Cntn5 T A 9: 9,984,082 (GRCm39) Q382L possibly damaging Het
Cracdl T C 1: 37,663,364 (GRCm39) K845E possibly damaging Het
Dock2 A T 11: 34,598,169 (GRCm39) I334N probably damaging Het
Dock9 G T 14: 121,862,617 (GRCm39) T833K probably benign Het
Drd2 G A 9: 49,313,442 (GRCm39) V204I probably benign Het
Fam120a A T 13: 49,039,342 (GRCm39) I938N possibly damaging Het
Fndc1 T C 17: 7,990,621 (GRCm39) E1025G unknown Het
Fsip2 G A 2: 82,774,504 (GRCm39) D64N probably benign Het
Gm14496 T A 2: 181,641,989 (GRCm39) C553* probably null Het
Gm15587 C G 5: 24,572,467 (GRCm39) probably benign Het
Gm6020 C T 19: 61,172,391 (GRCm39) H22Y possibly damaging Het
Gvin3 A T 7: 106,196,630 (GRCm39) noncoding transcript Het
Hexa A G 9: 59,464,586 (GRCm39) T159A probably benign Het
Hmcn1 C G 1: 150,695,251 (GRCm39) A218P possibly damaging Het
Hpgds A G 6: 65,115,217 (GRCm39) F22S probably damaging Het
Il5ra T A 6: 106,708,874 (GRCm39) N289Y probably damaging Het
Ilf2 T C 3: 90,394,767 (GRCm39) probably benign Het
Irf2 A T 8: 47,260,388 (GRCm39) R107* probably null Het
Kcnk6 T C 7: 28,925,075 (GRCm39) I180M probably benign Het
Krtap5-3 G A 7: 141,755,979 (GRCm39) probably benign Het
Lrig1 C T 6: 94,631,859 (GRCm39) A114T probably benign Het
Lrrc37a A G 11: 103,389,587 (GRCm39) V1946A probably benign Het
Lrrc8b T C 5: 105,629,217 (GRCm39) V521A probably benign Het
Macf1 T G 4: 123,348,835 (GRCm39) I2154L possibly damaging Het
Macf1 C A 4: 123,368,505 (GRCm39) E2085D probably benign Het
Maml1 C T 11: 50,157,468 (GRCm39) A236T probably benign Het
Mdc1 C A 17: 36,165,117 (GRCm39) T1481K probably benign Het
Mecp2 C T X: 73,080,781 (GRCm39) A79T probably damaging Homo
Med24 A G 11: 98,598,108 (GRCm39) probably benign Het
Mfap3l T C 8: 61,124,424 (GRCm39) V222A possibly damaging Het
Mis18bp1 A G 12: 65,196,102 (GRCm39) I554T probably benign Het
Mpped2 T C 2: 106,529,790 (GRCm39) I13T probably benign Het
Mthfd1l C A 10: 4,056,528 (GRCm39) T948K probably damaging Het
Mtus1 C T 8: 41,537,362 (GRCm39) S118N probably damaging Het
Mtx3 A G 13: 92,984,191 (GRCm39) E156G probably benign Het
Myh2 G A 11: 67,071,676 (GRCm39) V498M probably damaging Het
Myo15b G A 11: 115,777,899 (GRCm39) G1049S probably damaging Het
Myo1b T A 1: 51,799,562 (GRCm39) probably null Het
Ndufa2 T A 18: 36,877,573 (GRCm39) probably benign Het
Nipal2 T C 15: 34,625,167 (GRCm39) I129M possibly damaging Het
Nt5dc3 A G 10: 86,669,926 (GRCm39) N507S possibly damaging Het
Or4b12 A G 2: 90,095,913 (GRCm39) L287P probably damaging Het
Or8b12b T A 9: 37,684,163 (GRCm39) D69E possibly damaging Het
Pcdhb17 G A 18: 37,620,438 (GRCm39) probably null Het
Pcyt2 A G 11: 120,508,677 (GRCm39) M1T probably null Het
Pear1 C A 3: 87,717,882 (GRCm39) probably benign Het
Pla2g2d T C 4: 138,503,126 (GRCm39) M1T probably null Het
Plekhg6 T C 6: 125,340,306 (GRCm39) T685A probably damaging Het
Pramel19 T A 4: 101,798,335 (GRCm39) V102E probably damaging Het
Pwwp4a G T X: 72,171,261 (GRCm39) G218C probably damaging Homo
Pxk T C 14: 8,151,540 (GRCm38) S452P probably damaging Het
Rab42 A T 4: 132,030,529 (GRCm39) D40E probably benign Het
Rapgef6 A C 11: 54,551,654 (GRCm39) T836P probably damaging Het
Rtn1 A G 12: 72,283,307 (GRCm39) probably benign Het
Serpina3a A G 12: 104,082,362 (GRCm39) D45G probably benign Het
Slco6b1 A G 1: 96,849,786 (GRCm39) noncoding transcript Het
Smad9 CTTT CTT 3: 54,696,600 (GRCm39) probably benign Het
Sntb1 T A 15: 55,612,745 (GRCm39) R278* probably null Het
Spice1 T G 16: 44,185,989 (GRCm39) S111A probably damaging Het
Stk40 T A 4: 126,019,538 (GRCm39) L90Q probably damaging Het
Syk A G 13: 52,794,826 (GRCm39) Y520C probably damaging Het
Syngr2 G A 11: 117,704,224 (GRCm39) V170M possibly damaging Het
Tcf12 A T 9: 71,765,816 (GRCm39) D541E possibly damaging Het
Tedc2 T A 17: 24,435,291 (GRCm39) E366V probably damaging Het
Tedc2 C A 17: 24,435,292 (GRCm39) E366* probably null Het
Tlr4 T C 4: 66,759,409 (GRCm39) V734A probably damaging Het
Tmem132a T C 19: 10,840,863 (GRCm39) E389G probably damaging Het
Tmem150b A G 7: 4,712,044 (GRCm39) I112T probably benign Het
Tmod1 C T 4: 46,097,069 (GRCm39) silent Het
Trbc1 G A 6: 41,512,570 (GRCm39) probably benign Het
Tril A G 6: 53,796,577 (GRCm39) L215P probably damaging Het
Trim24 G T 6: 37,934,013 (GRCm39) R652L probably damaging Het
Ttn G A 2: 76,623,151 (GRCm39) P15429S probably damaging Het
Ttn T A 2: 76,706,302 (GRCm39) probably benign Het
Tubgcp2 A G 7: 139,579,183 (GRCm39) V701A probably damaging Het
Tubgcp2 A G 7: 139,586,069 (GRCm39) F407L probably damaging Het
Usp45 T C 4: 21,784,811 (GRCm39) probably benign Het
Vmn1r30 A C 6: 58,412,475 (GRCm39) L119R possibly damaging Het
Washc5 A C 15: 59,231,174 (GRCm39) L363R probably damaging Het
Zan T C 5: 137,387,590 (GRCm39) T4874A unknown Het
Zfp420 A T 7: 29,573,933 (GRCm39) H51L probably damaging Het
Zfp512b C A 2: 181,230,235 (GRCm39) R497L probably damaging Het
Zmat4 A G 8: 24,505,177 (GRCm39) N139S probably damaging Het
Zng1 A T 19: 24,932,769 (GRCm39) V88D probably damaging Het
Other mutations in Mybbp1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00924:Mybbp1a APN 11 72,334,393 (GRCm39) missense probably damaging 1.00
IGL03240:Mybbp1a APN 11 72,336,492 (GRCm39) missense possibly damaging 0.95
IGL03271:Mybbp1a APN 11 72,334,744 (GRCm39) splice site probably benign
IGL03344:Mybbp1a APN 11 72,336,028 (GRCm39) missense probably damaging 1.00
fratelli UTSW 11 72,336,538 (GRCm39) missense probably benign 0.02
primi UTSW 11 72,333,727 (GRCm39) splice site probably null
sorelli UTSW 11 72,338,585 (GRCm39) missense possibly damaging 0.94
R0276:Mybbp1a UTSW 11 72,340,933 (GRCm39) splice site probably null
R0437:Mybbp1a UTSW 11 72,339,674 (GRCm39) missense possibly damaging 0.75
R0551:Mybbp1a UTSW 11 72,339,202 (GRCm39) missense probably benign 0.06
R1394:Mybbp1a UTSW 11 72,334,474 (GRCm39) missense probably damaging 1.00
R1667:Mybbp1a UTSW 11 72,336,043 (GRCm39) missense probably benign 0.00
R1888:Mybbp1a UTSW 11 72,336,863 (GRCm39) missense probably benign 0.18
R1891:Mybbp1a UTSW 11 72,336,863 (GRCm39) missense probably benign 0.18
R1894:Mybbp1a UTSW 11 72,336,863 (GRCm39) missense probably benign 0.18
R2074:Mybbp1a UTSW 11 72,332,271 (GRCm39) missense probably benign 0.01
R2257:Mybbp1a UTSW 11 72,337,021 (GRCm39) missense probably benign 0.10
R3739:Mybbp1a UTSW 11 72,339,563 (GRCm39) missense possibly damaging 0.77
R3983:Mybbp1a UTSW 11 72,337,996 (GRCm39) missense probably damaging 1.00
R4191:Mybbp1a UTSW 11 72,342,113 (GRCm39) missense probably damaging 0.97
R4660:Mybbp1a UTSW 11 72,336,538 (GRCm39) missense probably benign 0.02
R4667:Mybbp1a UTSW 11 72,338,797 (GRCm39) missense possibly damaging 0.94
R4769:Mybbp1a UTSW 11 72,336,466 (GRCm39) missense probably damaging 1.00
R4982:Mybbp1a UTSW 11 72,336,040 (GRCm39) missense probably damaging 0.99
R5451:Mybbp1a UTSW 11 72,338,939 (GRCm39) missense probably damaging 0.99
R5514:Mybbp1a UTSW 11 72,341,462 (GRCm39) missense possibly damaging 0.61
R5548:Mybbp1a UTSW 11 72,336,998 (GRCm39) missense probably damaging 1.00
R5673:Mybbp1a UTSW 11 72,335,751 (GRCm39) missense probably benign 0.30
R5947:Mybbp1a UTSW 11 72,333,257 (GRCm39) missense probably damaging 1.00
R6161:Mybbp1a UTSW 11 72,336,838 (GRCm39) missense probably damaging 1.00
R6785:Mybbp1a UTSW 11 72,338,392 (GRCm39) missense probably benign 0.00
R7154:Mybbp1a UTSW 11 72,338,468 (GRCm39) splice site probably null
R7227:Mybbp1a UTSW 11 72,338,585 (GRCm39) missense possibly damaging 0.94
R7238:Mybbp1a UTSW 11 72,334,338 (GRCm39) missense probably damaging 1.00
R7441:Mybbp1a UTSW 11 72,342,101 (GRCm39) missense probably benign 0.01
R7833:Mybbp1a UTSW 11 72,333,727 (GRCm39) splice site probably null
R8213:Mybbp1a UTSW 11 72,335,547 (GRCm39) missense probably damaging 1.00
R8324:Mybbp1a UTSW 11 72,336,114 (GRCm39) critical splice donor site probably null
R8474:Mybbp1a UTSW 11 72,338,563 (GRCm39) missense probably benign 0.01
R8972:Mybbp1a UTSW 11 72,337,076 (GRCm39) missense probably benign 0.35
R9018:Mybbp1a UTSW 11 72,334,420 (GRCm39) missense probably benign 0.09
R9380:Mybbp1a UTSW 11 72,333,668 (GRCm39) missense probably benign 0.24
R9505:Mybbp1a UTSW 11 72,339,897 (GRCm39) missense probably benign 0.26
X0050:Mybbp1a UTSW 11 72,332,503 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GCTGTCTTGTGAAACCTCCC -3'
(R):5'- ATACCTTGAAGATGTGGAGGCC -3'

Sequencing Primer
(F):5'- GTGAAACCTCCCTCCCTCTTAC -3'
(R):5'- CCACCAGAAGCAGCAGGTG -3'
Posted On 2015-04-17